Rmu_sc0023997.1_g000001

aldo-keto reductase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023997.1
Physical Location & Seq
Forward (+)
1 .. 425
425 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023997.1_g000001.1.cds

Sequence Viewer

Length: 251 bp
gtgttgaagtgtttcaggcattgaagcagctgcctcgagataaggttcaggttgctacaaagtttggtattgtaaatatcaagaaaccacaagttacacttaatagcagtcctgagtatatacgctcctgctgcgaggctagcctgaagcgtcttgatgtggggtacattgatctttactatcagcaccgtgtagacccatcaataccaatagaggataccgtgagtattacacattttcccttggactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.38

Weight (kDa)

6.89

Isoelectric Point (pI)

40.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 194
AcuI CTGAAG 1 cut(s) 166
AfaI GTAC 1 cut(s) 166
AgsI TTSAA 2 cut(s) 7, 24
AluBI AGCT 1 cut(s) 30
AluI AGCT 1 cut(s) 30
Ama87I CYCGRG 1 cut(s) 35
ApeKI GCWGC 3 cut(s) 27, 30, 131
Asp700I GAANNNNTTC 1 cut(s) 11
AsuNHI GCTAGC 1 cut(s) 139
AvaI CYCGRG 1 cut(s) 35
BbvI GCAGC 3 cut(s) 17, 39, 118
BccI CCATC 1 cut(s) 207
BcgI CGANNNNNNTGC 2 cut(s) 16, 50
BciVI GTATCC 1 cut(s) 210
BfaI CTAG 1 cut(s) 140
BfuI GTATCC 1 cut(s) 210
BisI GCNGC 3 cut(s) 28, 31, 132
BlsI GCNGC 3 cut(s) 29, 32, 133
BmeT110I CYCGRG 1 cut(s) 35
BmtI GCTAGC 1 cut(s) 143
BsaJI CCNNGG 1 cut(s) 242
BseDI CCNNGG 1 cut(s) 242
BseMII CTCAG 1 cut(s) 104
BseXI GCAGC 3 cut(s) 17, 39, 118
BsiHKCI CYCGRG 1 cut(s) 35
BsoBI CYCGRG 1 cut(s) 35
Bsp143I GATC 1 cut(s) 171
BspCNI CTCAG 1 cut(s) 105
BspOI GCTAGC 1 cut(s) 143
BssECI CCNNGG 1 cut(s) 242
BssMI GATC 1 cut(s) 171
BssT1I CCWWGG 1 cut(s) 242
Bst4CI ACNGT 2 cut(s) 190, 222
BstC8I GCNNGC 1 cut(s) 141
BstDEI CTNAG 1 cut(s) 113
BstKTI GATC 1 cut(s) 174
BstMBI GATC 1 cut(s) 171
BstMWI GCNNNNNNNGC 2 cut(s) 131, 140
BstV1I GCAGC 3 cut(s) 17, 39, 118
BsuI GTATCC 1 cut(s) 210
Cac8I GCNNGC 1 cut(s) 141
CseI GACGC 1 cut(s) 139
Csp6I GTAC 1 cut(s) 165
CviJI RGCY 3 cut(s) 30, 139, 143
CviKI_1 RGCY 3 cut(s) 30, 139, 143
CviQI GTAC 1 cut(s) 165
DdeI CTNAG 1 cut(s) 113
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
Eco130I CCWWGG 1 cut(s) 242
Eco57I CTGAAG 1 cut(s) 166
Eco88I CYCGRG 1 cut(s) 35
EcoT14I CCWWGG 1 cut(s) 242
ErhI CCWWGG 1 cut(s) 242
FaiI YATR 2 cut(s) 119, 121
FalI AAGNNNNNCTT 2 cut(s) 83, 115
FblI GTMKAC 1 cut(s) 194
Fnu4HI GCNGC 3 cut(s) 28, 31, 132
Fsp4HI GCNGC 3 cut(s) 28, 31, 132
FspBI CTAG 1 cut(s) 140
GluI GCNGC 3 cut(s) 28, 31, 132
HgaI GACGC 1 cut(s) 139
Hpy166II GTNNAC 1 cut(s) 195
Hpy188III TCNNGA 4 cut(s) 37, 81, 112, 154
Hpy8I GTNNAC 1 cut(s) 195
HpyCH4III ACNGT 2 cut(s) 190, 222
HpyF10VI GCNNNNNNNGC 2 cut(s) 131, 140
HpyF3I CTNAG 1 cut(s) 113
Kzo9I GATC 1 cut(s) 171
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 4 cut(s) 34, 125, 141, 157
Lsp1109I GCAGC 3 cut(s) 17, 39, 118
MaeI CTAG 1 cut(s) 140
MaeIII GTNAC 1 cut(s) 93
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MnlI CCTC 3 cut(s) 44, 129, 207
MroXI GAANNNNTTC 1 cut(s) 11
MseI TTAA 1 cut(s) 101
MspA1I CMGCKG 1 cut(s) 30
MwoI GCNNNNNNNGC 2 cut(s) 131, 140
NdeII GATC 1 cut(s) 171
NheI GCTAGC 1 cut(s) 139
PaeR7I CTCGAG 1 cut(s) 35
PdmI GAANNNNTTC 1 cut(s) 11
PkrI GCNGC 3 cut(s) 29, 32, 133
PvuII CAGCTG 1 cut(s) 30
RsaI GTAC 1 cut(s) 166
RsaNI GTAC 1 cut(s) 165
SaqAI TTAA 1 cut(s) 101
SatI GCNGC 3 cut(s) 28, 31, 132
Sau3AI GATC 1 cut(s) 171
SetI ASST 3 cut(s) 32, 47, 53
Sfr274I CTCGAG 1 cut(s) 35
SlaI CTCGAG 1 cut(s) 35
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
SspMI CTAG 1 cut(s) 140
StyI CCWWGG 1 cut(s) 242
TaaI ACNGT 2 cut(s) 190, 222
TaqI TCGA 1 cut(s) 36
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TseI GCWGC 3 cut(s) 27, 30, 131
XhoI CTCGAG 1 cut(s) 35
XmiI GTMKAC 1 cut(s) 194
XmnI GAANNNNTTC 1 cut(s) 11
XspI CTAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.