RchiOBHm_Chr3g0488691

Phosphoethanolamine N-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
36342244 .. 36346777
4534 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45301

Sequence Viewer

Length: 183 bp
ATGATATACAGCCGTGACACCATTCTGCACATTCAACCAGGAGGCAAAGTTCTCATCAATGATTACTGTAGGAGTGCTGGCACTCCGTCGGTTGGATTTTCTGAGTACATTATGCAAAGAGGATATGAACTCCATGATGTAAAAGCATGTGGTCAGATGCTCAAGGATGCTGGTTTTGATTAG

Protein Analysis

60

Amino Acids

6.7

Weight (kDa)

6.02

Isoelectric Point (pI)

36.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 107
AfiI CCNNNNNNNGG 1 cut(s) 92
AgsI TTSAA 1 cut(s) 35
AjnI CCWGG 1 cut(s) 37
AloI GAACNNNNNNTCC 2 cut(s) 33, 65
BciT130I CCWGG 1 cut(s) 39
BfmI CTRYAG 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 39
BmrFI CCNGG 1 cut(s) 39
BmsI GCATC 2 cut(s) 147, 157
BpuEI CTTGAG 1 cut(s) 146
BsaXI ACNNNNNCTCC 2 cut(s) 33, 63
Bsc4I CCNNNNNNNGG 1 cut(s) 92
BseBI CCWGG 1 cut(s) 39
BseGI GGATG 1 cut(s) 172
BseLI CCNNNNNNNGG 1 cut(s) 92
BseMII CTCAG 1 cut(s) 93
BsgI GTGCAG 1 cut(s) 11
BslI CCNNNNNNNGG 1 cut(s) 92
BspCNI CTCAG 1 cut(s) 94
Bst2UI CCWGG 1 cut(s) 39
Bst4CI ACNGT 1 cut(s) 68
BstC8I GCNNGC 1 cut(s) 79
BstDEI CTNAG 1 cut(s) 102
BstF5I GGATG 1 cut(s) 172
BstNI CCWGG 1 cut(s) 39
BstNSI RCATGY 1 cut(s) 150
BstSCI CCNGG 1 cut(s) 37
BstSFI CTRYAG 1 cut(s) 67
BtsCI GGATG 1 cut(s) 172
Cac8I GCNNGC 1 cut(s) 79
Csp6I GTAC 1 cut(s) 106
CviAII CATG 2 cut(s) 134, 147
CviJI RGCY 1 cut(s) 12
CviKI_1 RGCY 1 cut(s) 12
CviQI GTAC 1 cut(s) 106
DdeI CTNAG 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 37
FaeI CATG 2 cut(s) 137, 150
FaiI YATR 5 cut(s) 7, 113, 126, 135, 148
FatI CATG 2 cut(s) 133, 146
FokI GGATG 1 cut(s) 179
Hin1II CATG 2 cut(s) 137, 150
Hpy188I TCNGA 2 cut(s) 103, 156
Hpy99I CGWCG 1 cut(s) 91
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4V TGCA 2 cut(s) 28, 115
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 2 cut(s) 137, 150
LpnPI CCDG 4 cut(s) 24, 51, 63, 156
LweI GCATC 2 cut(s) 147, 157
MaeIII GTNAC 1 cut(s) 14
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 2 cut(s) 35, 113
MspR9I CCNGG 1 cut(s) 39
MvaI CCWGG 1 cut(s) 39
NlaIII CATG 2 cut(s) 137, 150
NmuCI GTSAC 1 cut(s) 14
NspI RCATGY 1 cut(s) 150
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
RsaI GTAC 1 cut(s) 107
RsaNI GTAC 1 cut(s) 106
ScrFI CCNGG 1 cut(s) 39
SfaNI GCATC 2 cut(s) 147, 157
SfcI CTRYAG 1 cut(s) 67
SgeI CNNG 7 cut(s) 26, 50, 51, 90, 146, 159, 175
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
StyD4I CCNGG 1 cut(s) 37
TaaI ACNGT 1 cut(s) 68
TatI WGTACW 1 cut(s) 105
TseFI GTSAC 1 cut(s) 14
Tsp45I GTSAC 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 141
TspGWI ACGGA 1 cut(s) 75
XceI RCATGY 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.