Rw0G013680

Phosphoethanolamine N-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00614
Physical Location & Seq
Forward (+)
7978 .. 9034
1057 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G013680.1

Sequence Viewer

Length: 312 bp
ATGATATACAGCCGTGACACCATTCTGCACATTCAAGACAAGCCTGCATTGTTCCGATCCTTTTACAAGTGGTTGAAGCCAGGAGGCAAAGTTCTCATCAATGATTACTGTAGGAGTGCTGGCACTCCGTCGGTTGAGTTTTCTGAGTACATTATGCAAAGAGGATATGAACTCCATGATGTAAAAGCATGTGGTCAGATGCTCAAGGATGCTGGTTTTGATGAGGTCATTGCTGAGAATCGTACTGAACAGCGGGAATTGAATGCTGTTGAGAAGGACAAGGAAGCAAGCATTCATCCAGGACTTTTCTGA

Protein Analysis

103

Amino Acids

11.86

Weight (kDa)

5.89

Isoelectric Point (pI)

37.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_23 PF13489 2 - 74 4.5e-08 Methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 253
AclWI GGATC 1 cut(s) 51
AfaI GTAC 2 cut(s) 149, 244
AgsI TTSAA 3 cut(s) 35, 76, 262
AjnI CCWGG 2 cut(s) 79, 298
AloI GAACNNNNNNTCC 2 cut(s) 75, 107
AlwI GGATC 1 cut(s) 51
BciT130I CCWGG 2 cut(s) 81, 300
BfmI CTRYAG 1 cut(s) 109
Bme1390I CCNGG 2 cut(s) 81, 300
BmrFI CCNGG 2 cut(s) 81, 300
BmsI GCATC 2 cut(s) 189, 199
BpuEI CTTGAG 1 cut(s) 188
BsaXI ACNNNNNCTCC 2 cut(s) 75, 105
Bse3DI GCAATG 1 cut(s) 228
BseBI CCWGG 2 cut(s) 81, 300
BseGI GGATG 2 cut(s) 214, 295
BseMI GCAATG 1 cut(s) 228
BseMII CTCAG 2 cut(s) 135, 225
BsgI GTGCAG 1 cut(s) 11
BsmI GAATGC 2 cut(s) 268, 291
Bsp143I GATC 1 cut(s) 56
BspACI CCGC 1 cut(s) 253
BspCNI CTCAG 2 cut(s) 136, 226
BspPI GGATC 1 cut(s) 51
BsrDI GCAATG 1 cut(s) 228
BssMI GATC 1 cut(s) 56
Bst2UI CCWGG 2 cut(s) 81, 300
Bst4CI ACNGT 1 cut(s) 110
BstC8I GCNNGC 3 cut(s) 45, 121, 289
BstDEI CTNAG 2 cut(s) 144, 234
BstF5I GGATG 2 cut(s) 214, 295
BstKTI GATC 1 cut(s) 59
BstMBI GATC 1 cut(s) 56
BstNI CCWGG 2 cut(s) 81, 300
BstNSI RCATGY 1 cut(s) 192
BstSCI CCNGG 2 cut(s) 79, 298
BstSFI CTRYAG 1 cut(s) 109
BtsCI GGATG 2 cut(s) 214, 295
Cac8I GCNNGC 3 cut(s) 45, 121, 289
Csp6I GTAC 2 cut(s) 148, 243
CviAII CATG 2 cut(s) 176, 189
CviJI RGCY 3 cut(s) 12, 43, 79
CviKI_1 RGCY 3 cut(s) 12, 43, 79
CviQI GTAC 2 cut(s) 148, 243
DdeI CTNAG 2 cut(s) 144, 234
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
EcoRII CCWGG 2 cut(s) 79, 298
FaeI CATG 2 cut(s) 179, 192
FaiI YATR 5 cut(s) 7, 155, 168, 177, 190
FatI CATG 2 cut(s) 175, 188
FauI CCCGC 1 cut(s) 246
FokI GGATG 2 cut(s) 221, 282
Hin1II CATG 2 cut(s) 179, 192
HinfI GANTC 1 cut(s) 238
Hpy188I TCNGA 4 cut(s) 56, 145, 198, 311
Hpy188III TCNNGA 1 cut(s) 35
Hpy99I CGWCG 1 cut(s) 133
HpyAV CCTTC 1 cut(s) 268
HpyCH4III ACNGT 1 cut(s) 110
HpyCH4V TGCA 3 cut(s) 28, 47, 157
HpyF3I CTNAG 2 cut(s) 144, 234
Hsp92II CATG 2 cut(s) 179, 192
Kzo9I GATC 1 cut(s) 56
LpnPI CCDG 6 cut(s) 57, 66, 93, 105, 198, 285
LweI GCATC 2 cut(s) 189, 199
MaeIII GTNAC 1 cut(s) 14
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MluCI AATT 1 cut(s) 257
MnlI CCTC 3 cut(s) 77, 155, 217
MspA1I CMGCKG 1 cut(s) 253
MspR9I CCNGG 2 cut(s) 81, 300
Mva1269I GAATGC 2 cut(s) 268, 291
MvaI CCWGG 2 cut(s) 81, 300
NdeII GATC 1 cut(s) 56
NlaIII CATG 2 cut(s) 179, 192
NmuCI GTSAC 1 cut(s) 14
NspI RCATGY 1 cut(s) 192
PctI GAATGC 2 cut(s) 268, 291
PfeI GAWTC 1 cut(s) 238
PfoI TCCNGGA 1 cut(s) 298
Psp6I CCWGG 2 cut(s) 79, 298
PspGI CCWGG 2 cut(s) 79, 298
RsaI GTAC 2 cut(s) 149, 244
RsaNI GTAC 2 cut(s) 148, 243
Sau3AI GATC 1 cut(s) 56
ScrFI CCNGG 2 cut(s) 81, 300
SetI ASST 1 cut(s) 228
SfaNI GCATC 2 cut(s) 189, 199
SfcI CTRYAG 1 cut(s) 109
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 1 cut(s) 257
SsiI CCGC 1 cut(s) 253
StyD4I CCNGG 2 cut(s) 79, 298
TaaI ACNGT 1 cut(s) 110
TasI AATT 1 cut(s) 257
TatI WGTACW 1 cut(s) 147
TfiI GAWTC 1 cut(s) 238
TseFI GTSAC 1 cut(s) 14
Tsp45I GTSAC 1 cut(s) 14
TspDTI ATGAA 2 cut(s) 183, 284
TspGWI ACGGA 1 cut(s) 117
XceI RCATGY 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.