RchiOBHm_Chr4g0384911

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0017411
Physical Location & Seq
Forward (+)
283979 .. 284534
556 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35845

Sequence Viewer

Length: 249 bp
ATGTATTCACGTTCAGAACCAGAAAGGAAGGAAGAGAGAAAGAAAGAAGGAGAGAAAGAGAAAGAGAAAGAAAGAAGGAGAGAAAGAGAAAGGAGATCCGTCCAAACCGTCGACATTTTGGAGAAACCTCAAGTTGAGAAAAATGCTAGAAAGGTTGAGATGAAGCTGCTGCCAAAATTTGGTGACCATCGGAGAAGTTGGCCGCCTCGTGAACAGTGGCGCCGCGTGAATAGTGCAACGCGTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

10.25

Weight (kDa)

10.26

Isoelectric Point (pI)

81.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 219
AccB7I CCANNNNNTGG 1 cut(s) 179
AccI GTMKAC 1 cut(s) 111
AccII CGCG 2 cut(s) 225, 241
AciI CCGC 2 cut(s) 203, 223
AclWI GGATC 1 cut(s) 90
AcoI YGGCCR 1 cut(s) 200
AcsI RAATTY 1 cut(s) 176
AcyI GRCGYC 1 cut(s) 220
AfiI CCNNNNNNNGG 1 cut(s) 179
AflIII ACRYGT 1 cut(s) 239
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
AlwI GGATC 1 cut(s) 90
AoxI GGCC 1 cut(s) 200
ApeKI GCWGC 2 cut(s) 166, 169
ApoI RAATTY 1 cut(s) 176
AspLEI GCGC 1 cut(s) 222
AsuHPI GGTGA 1 cut(s) 194
BanI GGYRCC 1 cut(s) 219
BauI CACGAG 1 cut(s) 207
BbvI GCAGC 2 cut(s) 153, 156
BccI CCATC 1 cut(s) 195
BfaI CTAG 1 cut(s) 147
BfoI RGCGCY 1 cut(s) 223
BisI GCNGC 4 cut(s) 167, 170, 203, 223
BlsI GCNGC 4 cut(s) 168, 171, 204, 224
BmiI GGNNCC 1 cut(s) 221
BpuEI CTTGAG 1 cut(s) 114
BsaHI GRCGYC 1 cut(s) 220
Bsc4I CCNNNNNNNGG 1 cut(s) 179
BseLI CCNNNNNNNGG 1 cut(s) 179
BseXI GCAGC 2 cut(s) 153, 156
Bsh1236I CGCG 2 cut(s) 225, 241
BshFI GGCC 1 cut(s) 202
BshNI GGYRCC 1 cut(s) 219
BslI CCNNNNNNNGG 1 cut(s) 179
BsnI GGCC 1 cut(s) 202
Bsp143I GATC 1 cut(s) 95
BspACI CCGC 2 cut(s) 203, 223
BspANI GGCC 1 cut(s) 202
BspFNI CGCG 2 cut(s) 225, 241
BspLI GGNNCC 1 cut(s) 221
BspPI GGATC 1 cut(s) 90
BspT107I GGYRCC 1 cut(s) 219
BssMI GATC 1 cut(s) 95
BssNI GRCGYC 1 cut(s) 220
BssSI CACGAG 1 cut(s) 207
Bst2BI CACGAG 1 cut(s) 207
Bst4CI ACNGT 2 cut(s) 109, 216
Bst6I CTCTTC 1 cut(s) 27
BstACI GRCGYC 1 cut(s) 220
BstEII GGTNACC 1 cut(s) 182
BstFNI CGCG 2 cut(s) 225, 241
BstH2I RGCGCY 1 cut(s) 223
BstHHI GCGC 1 cut(s) 222
BstKTI GATC 1 cut(s) 98
BstMBI GATC 1 cut(s) 95
BstPI GGTNACC 1 cut(s) 182
BstUI CGCG 2 cut(s) 225, 241
BstV1I GCAGC 2 cut(s) 153, 156
BstX2I RGATCY 1 cut(s) 95
BstYI RGATCY 1 cut(s) 95
BsuRI GGCC 1 cut(s) 202
BtsIMutI CAGTG 1 cut(s) 221
CfoI GCGC 1 cut(s) 222
CviJI RGCY 2 cut(s) 166, 202
CviKI_1 RGCY 2 cut(s) 166, 202
DinI GGCGCC 1 cut(s) 221
DpnI GATC 1 cut(s) 97
DpnII GATC 1 cut(s) 95
EaeI YGGCCR 1 cut(s) 200
Eam1104I CTCTTC 1 cut(s) 27
EarI CTCTTC 1 cut(s) 27
Eco91I GGTNACC 1 cut(s) 182
EcoO65I GGTNACC 1 cut(s) 182
EgeI GGCGCC 1 cut(s) 221
EheI GGCGCC 1 cut(s) 221
FblI GTMKAC 1 cut(s) 111
Fnu4HI GCNGC 4 cut(s) 167, 170, 203, 223
Fsp4HI GCNGC 4 cut(s) 167, 170, 203, 223
FspBI CTAG 1 cut(s) 147
GlaI GCGC 1 cut(s) 221
GluI GCNGC 4 cut(s) 167, 170, 203, 223
HaeII RGCGCY 1 cut(s) 223
HaeIII GGCC 1 cut(s) 202
HhaI GCGC 1 cut(s) 222
Hin1I GRCGYC 1 cut(s) 220
Hin6I GCGC 1 cut(s) 220
HinP1I GCGC 1 cut(s) 220
HincII GTYRAC 1 cut(s) 112
HindII GTYRAC 1 cut(s) 112
HphI GGTGA 1 cut(s) 194
Hpy166II GTNNAC 2 cut(s) 112, 212
Hpy188I TCNGA 2 cut(s) 16, 192
Hpy188III TCNNGA 1 cut(s) 209
Hpy8I GTNNAC 2 cut(s) 112, 212
Hpy99I CGWCG 1 cut(s) 113
HpyAV CCTTC 3 cut(s) 22, 41, 69
HpyCH4III ACNGT 2 cut(s) 109, 216
HpyCH4IV ACGT 1 cut(s) 10
HpyCH4V TGCA 1 cut(s) 236
HpySE526I ACGT 1 cut(s) 10
Hsp92I GRCGYC 1 cut(s) 220
HspAI GCGC 1 cut(s) 220
KasI GGCGCC 1 cut(s) 219
Kzo9I GATC 1 cut(s) 95
LpnPI CCDG 1 cut(s) 33
Lsp1109I GCAGC 2 cut(s) 153, 156
MaeI CTAG 1 cut(s) 147
MaeII ACGT 1 cut(s) 10
MaeIII GTNAC 1 cut(s) 182
MalI GATC 1 cut(s) 97
MboI GATC 1 cut(s) 95
MboII GAAGA 1 cut(s) 44
MflI RGATCY 1 cut(s) 95
MluCI AATT 1 cut(s) 176
MluI ACGCGT 1 cut(s) 239
Mly113I GGCGCC 1 cut(s) 220
MnlI CCTC 2 cut(s) 138, 216
MvnI CGCG 2 cut(s) 225, 241
NarI GGCGCC 1 cut(s) 220
NdeII GATC 1 cut(s) 95
NlaIV GGNNCC 1 cut(s) 221
NmuCI GTSAC 1 cut(s) 182
PflMI CCANNNNNTGG 1 cut(s) 179
PkrI GCNGC 4 cut(s) 168, 171, 204, 224
PluTI GGCGCC 1 cut(s) 223
PspEI GGTNACC 1 cut(s) 182
PspN4I GGNNCC 1 cut(s) 221
PsuI RGATCY 1 cut(s) 95
SalI GTCGAC 1 cut(s) 110
SatI GCNGC 4 cut(s) 167, 170, 203, 223
Sau3AI GATC 1 cut(s) 95
SetI ASST 4 cut(s) 13, 130, 156, 168
SfoI GGCGCC 1 cut(s) 221
SgeI CNNG 8 cut(s) 21, 32, 143, 159, 219, 221, 236, 238
SmlI CTYRAG 1 cut(s) 129
SmoI CTYRAG 1 cut(s) 129
Sse9I AATT 1 cut(s) 176
SsiI CCGC 2 cut(s) 203, 223
SspDI GGCGCC 1 cut(s) 219
SspMI CTAG 1 cut(s) 147
TaaI ACNGT 2 cut(s) 109, 216
TaiI ACGT 1 cut(s) 13
TaqI TCGA 1 cut(s) 111
TasI AATT 1 cut(s) 176
TauI GCSGC 2 cut(s) 205, 225
TscAI CASTG 1 cut(s) 221
TseFI GTSAC 1 cut(s) 182
TseI GCWGC 2 cut(s) 166, 169
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 1 cut(s) 176
TspGWI ACGGA 1 cut(s) 88
TspRI CASTG 1 cut(s) 221
Van91I CCANNNNNTGG 1 cut(s) 179
XapI RAATTY 1 cut(s) 176
XmiI GTMKAC 1 cut(s) 111
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.