Rh7AG033900

PB1 domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0017411
Physical Location & Seq
Forward (+)
2354650 .. 2354907
258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG033900.1

Sequence Viewer

Length: 258 bp
ATGCACGAGTACGATCGCCTCTACAGGGCCTCCGCCAGGATGAGGTTGTTTCTCTTTCCGGTCAATCACAACGACAGTTTCGGGTCTGACAAGTCGTCCGATAGGGATTGCTTCATTGAGGCTTTGAATTCGGGTCCTGAGACAAAAATAAGAAGGTGGAGTGGAGCCTCTCCGGCTGAGATGCTAGATCTGGTGGCCAGTATGGAGGACCACGACGTCGAGCCCAACACAAGCTGTCCTCTTTTTTTTGGGTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PB1

Protein Analysis

85

Amino Acids

9.73

Weight (kDa)

4.97

Isoelectric Point (pI)

61.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 215
AatII GACGTC 1 cut(s) 219
AciI CCGC 1 cut(s) 33
AcoI YGGCCR 1 cut(s) 195
AcsI RAATTY 1 cut(s) 127
AcyI GRCGYC 1 cut(s) 216
AfaI GTAC 1 cut(s) 11
AfiI CCNNNNNNNGG 3 cut(s) 25, 36, 42
AgsI TTSAA 1 cut(s) 127
AhdI GACNNNNNGTC 1 cut(s) 94
AjnI CCWGG 1 cut(s) 35
AluBI AGCT 1 cut(s) 234
AluI AGCT 1 cut(s) 234
Alw26I GTCTC 1 cut(s) 134
AoxI GGCC 2 cut(s) 27, 195
ApoI RAATTY 1 cut(s) 127
AspS9I GGNCC 3 cut(s) 27, 134, 208
AvaII GGWCC 2 cut(s) 134, 208
BalI TGGCCA 1 cut(s) 197
BanII GRGCYC 1 cut(s) 225
BauI CACGAG 1 cut(s) 5
BciT130I CCWGG 1 cut(s) 37
BcoDI GTCTC 1 cut(s) 134
BfaI CTAG 1 cut(s) 185
BfmI CTRYAG 1 cut(s) 22
BglI GCCNNNNNGGC 1 cut(s) 173
BglII AGATCT 1 cut(s) 187
Bme1390I CCNGG 1 cut(s) 37
Bme18I GGWCC 2 cut(s) 134, 208
BmeRI GACNNNNNGTC 1 cut(s) 94
BmgT120I GGNCC 3 cut(s) 27, 134, 208
BmiI GGNNCC 2 cut(s) 135, 166
BmrFI CCNGG 1 cut(s) 37
BmsI GCATC 1 cut(s) 171
BsaHI GRCGYC 1 cut(s) 216
BsaWI WCCGGW 1 cut(s) 58
BsaXI ACNNNNNCTCC 2 cut(s) 14, 44
Bsc4I CCNNNNNNNGG 3 cut(s) 25, 36, 42
Bse1I ACTGG 1 cut(s) 198
BseBI CCWGG 1 cut(s) 37
BseGI GGATG 1 cut(s) 45
BseLI CCNNNNNNNGG 3 cut(s) 25, 36, 42
BseMII CTCAG 2 cut(s) 129, 168
BseNI ACTGG 1 cut(s) 198
Bsh1285I CGRYCG 1 cut(s) 16
BshFI GGCC 2 cut(s) 29, 197
BsiEI CGRYCG 1 cut(s) 16
BsiSI CCGG 2 cut(s) 59, 173
BslI CCNNNNNNNGG 3 cut(s) 25, 36, 42
BsmAI GTCTC 1 cut(s) 134
BsnI GGCC 2 cut(s) 29, 197
Bsp1286I GDGCHC 1 cut(s) 225
Bsp143I GATC 2 cut(s) 13, 187
BspACI CCGC 1 cut(s) 33
BspANI GGCC 2 cut(s) 29, 197
BspCNI CTCAG 2 cut(s) 130, 169
BspLI GGNNCC 2 cut(s) 135, 166
BsrI ACTGG 1 cut(s) 198
BssMI GATC 2 cut(s) 13, 187
BssNI GRCGYC 1 cut(s) 216
BssSI CACGAG 1 cut(s) 5
Bst2BI CACGAG 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 37
Bst4CI ACNGT 1 cut(s) 77
BstACI GRCGYC 1 cut(s) 216
BstDEI CTNAG 2 cut(s) 138, 177
BstENI CCTNNNNNAGG 1 cut(s) 34
BstF5I GGATG 1 cut(s) 45
BstKTI GATC 2 cut(s) 16, 190
BstMAI GTCTC 1 cut(s) 134
BstMBI GATC 2 cut(s) 13, 187
BstMCI CGRYCG 1 cut(s) 16
BstMWI GCNNNNNNNGC 1 cut(s) 173
BstNI CCWGG 1 cut(s) 37
BstSCI CCNGG 1 cut(s) 35
BstSFI CTRYAG 1 cut(s) 22
BstX2I RGATCY 1 cut(s) 187
BstYI RGATCY 1 cut(s) 187
BsuRI GGCC 2 cut(s) 29, 197
BtsCI GGATG 1 cut(s) 45
Cfr13I GGNCC 3 cut(s) 27, 134, 208
Csp6I GTAC 1 cut(s) 10
CviJI RGCY 7 cut(s) 29, 122, 167, 176, 197, 223, 234
CviKI_1 RGCY 7 cut(s) 29, 122, 167, 176, 197, 223, 234
CviQI GTAC 1 cut(s) 10
DdeI CTNAG 2 cut(s) 138, 177
DpnI GATC 2 cut(s) 15, 189
DpnII GATC 2 cut(s) 13, 187
DrdI GACNNNNNNGTC 1 cut(s) 215
DriI GACNNNNNGTC 1 cut(s) 94
DseDI GACNNNNNNGTC 1 cut(s) 215
EaeI YGGCCR 1 cut(s) 195
Eam1105I GACNNNNNGTC 1 cut(s) 94
EciI GGCGGA 1 cut(s) 22
Eco24I GRGCYC 1 cut(s) 225
Eco47I GGWCC 2 cut(s) 134, 208
EcoNI CCTNNNNNAGG 1 cut(s) 34
EcoO109I RGGNCCY 2 cut(s) 27, 134
EcoRI GAATTC 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 35
EcoT38I GRGCYC 1 cut(s) 225
FaiI YATR 1 cut(s) 203
FokI GGATG 1 cut(s) 52
FriOI GRGCYC 1 cut(s) 225
FspBI CTAG 1 cut(s) 185
HaeIII GGCC 2 cut(s) 29, 197
HapII CCGG 2 cut(s) 59, 173
Hin1I GRCGYC 1 cut(s) 216
HpaII CCGG 2 cut(s) 59, 173
Hpy188I TCNGA 3 cut(s) 88, 100, 257
Hpy188III TCNNGA 1 cut(s) 137
Hpy99I CGWCG 2 cut(s) 218, 221
HpyAV CCTTC 1 cut(s) 147
HpyCH4III ACNGT 1 cut(s) 77
HpyCH4IV ACGT 1 cut(s) 216
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 173
HpyF3I CTNAG 2 cut(s) 138, 177
HpySE526I ACGT 1 cut(s) 216
Hsp92I GRCGYC 1 cut(s) 216
Kzo9I GATC 2 cut(s) 13, 187
LmnI GCTCC 1 cut(s) 164
LpnPI CCDG 8 cut(s) 10, 22, 49, 72, 150, 176, 186, 211
LweI GCATC 1 cut(s) 171
MaeI CTAG 1 cut(s) 185
MaeII ACGT 1 cut(s) 216
MalI GATC 2 cut(s) 15, 189
MboI GATC 2 cut(s) 13, 187
MflI RGATCY 1 cut(s) 187
MhlI GDGCHC 1 cut(s) 225
MlsI TGGCCA 1 cut(s) 197
MluCI AATT 1 cut(s) 127
MluNI TGGCCA 1 cut(s) 197
MnlI CCTC 7 cut(s) 29, 36, 40, 112, 178, 199, 249
Mox20I TGGCCA 1 cut(s) 197
MscI TGGCCA 1 cut(s) 197
Msp20I TGGCCA 1 cut(s) 197
MspI CCGG 2 cut(s) 59, 173
MspR9I CCNGG 1 cut(s) 37
MvaI CCWGG 1 cut(s) 37
MwoI GCNNNNNNNGC 1 cut(s) 173
NdeII GATC 2 cut(s) 13, 187
NlaIV GGNNCC 2 cut(s) 135, 166
Ple19I CGATCG 1 cut(s) 16
PpuMI RGGWCCY 1 cut(s) 134
Psp5II RGGWCCY 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 35
PspGI CCWGG 1 cut(s) 35
PspN4I GGNNCC 2 cut(s) 135, 166
PspPI GGNCC 3 cut(s) 27, 134, 208
PspPPI RGGWCCY 1 cut(s) 134
PsuI RGATCY 1 cut(s) 187
PvuI CGATCG 1 cut(s) 16
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
Sau3AI GATC 2 cut(s) 13, 187
Sau96I GGNCC 3 cut(s) 27, 134, 208
ScrFI CCNGG 1 cut(s) 37
SduI GDGCHC 1 cut(s) 225
SetI ASST 4 cut(s) 47, 158, 219, 236
SfaNI GCATC 1 cut(s) 171
SfcI CTRYAG 1 cut(s) 22
SinI GGWCC 2 cut(s) 134, 208
Sse9I AATT 1 cut(s) 127
SsiI CCGC 1 cut(s) 33
SspMI CTAG 1 cut(s) 185
StyD4I CCNGG 1 cut(s) 35
TaaI ACNGT 1 cut(s) 77
TaiI ACGT 1 cut(s) 219
TaqI TCGA 1 cut(s) 219
TasI AATT 1 cut(s) 127
TspDTI ATGAA 1 cut(s) 103
VpaK11BI GGWCC 2 cut(s) 134, 208
XagI CCTNNNNNAGG 1 cut(s) 34
XapI RAATTY 1 cut(s) 127
XspI CTAG 1 cut(s) 185
ZraI GACGTC 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.