Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0007259

Physical Location & Seq

Genomic Coordinates Forward (+)

23138031 .. 23138816

Gene Structure 786 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ30889

Sequence Viewer

CDS Protein Promoter (2k)

Length: 378 bp

ATGTCCAGCAACACTTTCACGGTTCTCATTCAAGTCTTTGTTTGCAGAATTAAAAGTGATTACCAGCCATGCTCTCCTTTAGTGAGCTCTCGATCAAGCGGTCTAAGAGTTTCAACAGCTGCGGGAGCAACAGCTGCAATGCTTTCAGCTGGCGGATTTCCAATGCCCATATTATCTCAGGACCTCCAGTATATGGTAAGAGAGCCCATTGCATTAGGAGCAGCCTCAAGCTTTATGCATGGGTTTATTAATCCTCAACAGTCCATGGAAGCTACATGGTTTTGTAAAGAGGGAATCATATACATTGATGGTACTCATGTCCGCTGTTCTGTAAAAAATGGGGATCGCATCGAGATATCTTCCAAGGCCCCAGTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00760 ko01100 map00760 map01100

Pfam Domains

Protein Families

NAD_kinase

Protein Analysis

125

Amino Acids

13.47

Weight (kDa)

8.43

Isoelectric Point (pI)

60.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007259)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G78590 AT1G78590
fragaria_vesca	FvH4_3g17730 FvH4_3g17730
malus_domestica	MD03G1247500.v1.1 MD03G1248900.v1.1 MD11G1270000.v1.1 MD11G1270100.v1.1
prunus_persica	Prupe.4G156300_v2.0.a1 Prupe.4G156300_v2.0.a1 Prupe.4G156300_v2.0.a1 Prupe.4G156300_v2.0.a1 Prupe.4G156400_v2.0.a1
pyrus_communis	pycom11g23850
rosa_chinensis	RchiOBHm_Chr5g0029501 RchiOBHm_Chr5g0029511
rosa_laevigata	RLG00000033174
rosa_multiflora	Rmu_sc0004181.1_g000011
rosa_roxburghii	Rroxscaffold_1G00050460
rosa_rugosa	Rorug05G0114300
rosa_samantha	Rh5AG206500 Rh5BG205200 Rh5CG227200 Rh5DG208800
rosa_wichuraiana	Rw5G018780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	193
AciI	CCGC	4 cut(s)	99, 122, 153, 322
AclWI	GGATC	1 cut(s)	351
AfaI	GTAC	1 cut(s)	313
AfiI	CCNNNNNNNGG	1 cut(s)	193
AgsI	TTSAA	2 cut(s)	32, 114
AluBI	AGCT	6 cut(s)	87, 119, 134, 149, 231, 272
AluI	AGCT	6 cut(s)	87, 119, 134, 149, 231, 272
Alw21I	GWGCWC	1 cut(s)	89
AlwI	GGATC	1 cut(s)	351
AoxI	GGCC	1 cut(s)	366
ApeKI	GCWGC	3 cut(s)	119, 134, 221
AseI	ATTAAT	1 cut(s)	249
AspS9I	GGNCC	2 cut(s)	181, 367
AvaII	GGWCC	1 cut(s)	181
BaeI	ACNNNNGTAYC	2 cut(s)	303, 336
BanII	GRGCYC	2 cut(s)	89, 207
Bbv12I	GWGCWC	1 cut(s)	89
BbvI	GCAGC	3 cut(s)	106, 121, 233
BccI	CCATC	1 cut(s)	302
BisI	GCNGC	3 cut(s)	120, 135, 222
BlsI	GCNGC	3 cut(s)	121, 136, 223
Bme18I	GGWCC	1 cut(s)	181
BmgT120I	GGNCC	2 cut(s)	181, 367
BmiI	GGNNCC	1 cut(s)	369
BmrI	ACTGGG	1 cut(s)	365
BmsI	GCATC	1 cut(s)	357
BmuI	ACTGGG	1 cut(s)	365
BpmI	CTGGAG	1 cut(s)	170
BpuEI	CTTGAG	1 cut(s)	211
BsaJI	CCNNGG	2 cut(s)	264, 363
Bsc4I	CCNNNNNNNGG	1 cut(s)	193
Bse1I	ACTGG	2 cut(s)	187, 371
Bse3DI	GCAATG	2 cut(s)	144, 207
BseDI	CCNNGG	2 cut(s)	264, 363
BseLI	CCNNNNNNNGG	1 cut(s)	193
BseMI	GCAATG	2 cut(s)	144, 207
BseMII	CTCAG	1 cut(s)	191
BseNI	ACTGG	2 cut(s)	187, 371
BseXI	GCAGC	3 cut(s)	106, 121, 233
BshFI	GGCC	1 cut(s)	368
BsiHKAI	GWGCWC	1 cut(s)	89
BslI	CCNNNNNNNGG	1 cut(s)	193
BsnI	GGCC	1 cut(s)	368
Bsp1286I	GDGCHC	2 cut(s)	89, 207
Bsp143I	GATC	2 cut(s)	92, 343
Bsp19I	CCATGG	1 cut(s)	264
BspACI	CCGC	4 cut(s)	99, 122, 153, 322
BspANI	GGCC	1 cut(s)	368
BspCNI	CTCAG	1 cut(s)	190
BspLI	GGNNCC	1 cut(s)	369
BspPI	GGATC	1 cut(s)	351
BsrDI	GCAATG	2 cut(s)	144, 207
BsrI	ACTGG	2 cut(s)	187, 371
BssECI	CCNNGG	2 cut(s)	264, 363
BssMI	GATC	2 cut(s)	92, 343
BssT1I	CCWWGG	2 cut(s)	264, 363
Bst4CI	ACNGT	2 cut(s)	22, 261
BstAPI	GCANNNNNTGC	1 cut(s)	134
BstC8I	GCNNGC	1 cut(s)	151
BstDEI	CTNAG	2 cut(s)	104, 177
BstDSI	CCRYGG	1 cut(s)	264
BstKTI	GATC	2 cut(s)	95, 346
BstMBI	GATC	2 cut(s)	92, 343
BstMWI	GCNNNNNNNGC	3 cut(s)	125, 134, 218
BstV1I	GCAGC	3 cut(s)	106, 121, 233
BsuRI	GGCC	1 cut(s)	368
BtgI	CCRYGG	1 cut(s)	264
Cac8I	GCNNGC	1 cut(s)	151
Cfr13I	GGNCC	2 cut(s)	181, 367
Csp6I	GTAC	1 cut(s)	312
CviAII	CATG	5 cut(s)	69, 239, 265, 276, 317
CviQI	GTAC	1 cut(s)	312
DdeI	CTNAG	2 cut(s)	104, 177
DpnI	GATC	2 cut(s)	94, 345
DpnII	GATC	2 cut(s)	92, 343
EciI	GGCGGA	1 cut(s)	168
Ecl136II	GAGCTC	1 cut(s)	87
Eco130I	CCWWGG	2 cut(s)	264, 363
Eco24I	GRGCYC	2 cut(s)	89, 207
Eco32I	GATATC	1 cut(s)	357
Eco47I	GGWCC	1 cut(s)	181
Eco53kI	GAGCTC	1 cut(s)	87
EcoICRI	GAGCTC	1 cut(s)	87
EcoO109I	RGGNCCY	2 cut(s)	181, 367
EcoRV	GATATC	1 cut(s)	357
EcoT14I	CCWWGG	2 cut(s)	264, 363
EcoT22I	ATGCAT	1 cut(s)	240
EcoT38I	GRGCYC	2 cut(s)	89, 207
ErhI	CCWWGG	2 cut(s)	264, 363
FaeI	CATG	5 cut(s)	72, 242, 268, 279, 320
FatI	CATG	5 cut(s)	68, 238, 264, 275, 316
FauI	CCCGC	1 cut(s)	115
Fnu4HI	GCNGC	3 cut(s)	120, 135, 222
FriOI	GRGCYC	2 cut(s)	89, 207
Fsp4HI	GCNGC	3 cut(s)	120, 135, 222
GluI	GCNGC	3 cut(s)	120, 135, 222
GsuI	CTGGAG	1 cut(s)	170
HaeIII	GGCC	1 cut(s)	368
Hin1II	CATG	5 cut(s)	72, 242, 268, 279, 320
HindIII	AAGCTT	1 cut(s)	229
HinfI	GANTC	1 cut(s)	294
Hpy188III	TCNNGA	3 cut(s)	90, 179, 352
HpyCH4III	ACNGT	2 cut(s)	22, 261
HpyCH4V	TGCA	4 cut(s)	45, 137, 212, 238
HpyF10VI	GCNNNNNNNGC	3 cut(s)	125, 134, 218
HpyF3I	CTNAG	2 cut(s)	104, 177
Hsp92II	CATG	5 cut(s)	72, 242, 268, 279, 320
Kzo9I	GATC	2 cut(s)	92, 343
LmnI	GCTCC	2 cut(s)	125, 218
LpnPI	CCDG	5 cut(s)	19, 77, 135, 164, 200
Lsp1109I	GCAGC	3 cut(s)	106, 121, 233
LweI	GCATC	1 cut(s)	357
MalI	GATC	2 cut(s)	94, 345
MboI	GATC	2 cut(s)	92, 343
MboII	GAAGA	1 cut(s)	351
MhlI	GDGCHC	2 cut(s)	89, 207
MluCI	AATT	1 cut(s)	48
MnlI	CCTC	4 cut(s)	194, 235, 264, 283
Mph1103I	ATGCAT	1 cut(s)	240
MseI	TTAA	2 cut(s)	51, 249
MspA1I	CMGCKG	4 cut(s)	119, 134, 149, 324
MwoI	GCNNNNNNNGC	3 cut(s)	125, 134, 218
NcoI	CCATGG	1 cut(s)	264
NdeII	GATC	2 cut(s)	92, 343
NlaIII	CATG	5 cut(s)	72, 242, 268, 279, 320
NlaIV	GGNNCC	1 cut(s)	369
NsiI	ATGCAT	1 cut(s)	240
PfeI	GAWTC	1 cut(s)	294
PflMI	CCANNNNNTGG	1 cut(s)	193
PkrI	GCNGC	3 cut(s)	121, 136, 223
PpuMI	RGGWCCY	1 cut(s)	181
PshBI	ATTAAT	1 cut(s)	249
Psp124BI	GAGCTC	1 cut(s)	89
Psp5II	RGGWCCY	1 cut(s)	181
PspN4I	GGNNCC	1 cut(s)	369
PspPI	GGNCC	2 cut(s)	181, 367
PspPPI	RGGWCCY	1 cut(s)	181
PvuII	CAGCTG	3 cut(s)	119, 134, 149
RsaI	GTAC	1 cut(s)	313
RsaNI	GTAC	1 cut(s)	312
SacI	GAGCTC	1 cut(s)	89
SaqAI	TTAA	2 cut(s)	51, 249
SatI	GCNGC	3 cut(s)	120, 135, 222
Sau3AI	GATC	2 cut(s)	92, 343
Sau96I	GGNCC	2 cut(s)	181, 367
SduI	GDGCHC	2 cut(s)	89, 207
SetI	ASST	7 cut(s)	89, 121, 136, 151, 186, 233, 274
SfaNI	GCATC	1 cut(s)	357
SinI	GGWCC	1 cut(s)	181
SmlI	CTYRAG	1 cut(s)	226
SmoI	CTYRAG	1 cut(s)	226
Sse9I	AATT	1 cut(s)	48
SsiI	CCGC	4 cut(s)	99, 122, 153, 322
SstI	GAGCTC	1 cut(s)	89
StyI	CCWWGG	2 cut(s)	264, 363
TaaI	ACNGT	2 cut(s)	22, 261
TaqI	TCGA	2 cut(s)	91, 351
TasI	AATT	1 cut(s)	48
TfiI	GAWTC	1 cut(s)	294
Tru1I	TTAA	2 cut(s)	51, 249
Tru9I	TTAA	2 cut(s)	51, 249
TseI	GCWGC	3 cut(s)	119, 134, 221
Van91I	CCANNNNNTGG	1 cut(s)	193
VpaK11BI	GGWCC	1 cut(s)	181
VspI	ATTAAT	1 cut(s)	249
Zsp2I	ATGCAT	1 cut(s)	240

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.