RchiOBHm_Chr5g0067791

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
73871569 .. 73874985
3417 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34346

Sequence Viewer

Length: 159 bp
ATGCTTGAAGCTTCAACATATCTTCTGGGATTGCTCTGGTTTCTTCCATCCTTTGTGGCAACTGGACTTCTTCATTCACGGTGGGTTGTGAGCTTCAACATTCGTTGTCTTCACTACTCAAGCAACCCTGCAGCCACCTTGTGTAGGCACGAACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.94

Weight (kDa)

7.88

Isoelectric Point (pI)

64.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 141
AfiI CCNNNNNNNGG 1 cut(s) 144
AgsI TTSAA 3 cut(s) 8, 15, 97
AluBI AGCT 2 cut(s) 11, 93
AluI AGCT 2 cut(s) 11, 93
ApeKI GCWGC 1 cut(s) 131
BbsI GAAGAC 1 cut(s) 101
BbvI GCAGC 1 cut(s) 143
BccI CCATC 1 cut(s) 55
BfmI CTRYAG 1 cut(s) 129
BisI GCNGC 1 cut(s) 132
BlsI GCNGC 1 cut(s) 133
BpiI GAAGAC 1 cut(s) 101
BpuEI CTTGAG 1 cut(s) 103
Bsc4I CCNNNNNNNGG 1 cut(s) 144
Bse1I ACTGG 1 cut(s) 67
BseGI GGATG 1 cut(s) 47
BseLI CCNNNNNNNGG 1 cut(s) 144
BseNI ACTGG 1 cut(s) 67
BseXI GCAGC 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 144
BspMAI CTGCAG 1 cut(s) 133
BsrI ACTGG 1 cut(s) 67
Bst4CI ACNGT 1 cut(s) 81
BstENI CCTNNNNNAGG 1 cut(s) 142
BstF5I GGATG 1 cut(s) 47
BstSFI CTRYAG 1 cut(s) 129
BstV1I GCAGC 1 cut(s) 143
BstV2I GAAGAC 1 cut(s) 101
BtsCI GGATG 1 cut(s) 47
CviJI RGCY 3 cut(s) 11, 93, 134
CviKI_1 RGCY 3 cut(s) 11, 93, 134
DraIII CACNNNGTG 1 cut(s) 141
EcoNI CCTNNNNNAGG 1 cut(s) 142
FaiI YATR 1 cut(s) 19
Fnu4HI GCNGC 1 cut(s) 132
FokI GGATG 1 cut(s) 34
Fsp4HI GCNGC 1 cut(s) 132
GluI GCNGC 1 cut(s) 132
HindIII AAGCTT 1 cut(s) 9
HpyCH4III ACNGT 1 cut(s) 81
HpyCH4V TGCA 1 cut(s) 131
LpnPI CCDG 4 cut(s) 11, 22, 48, 141
Lsp1109I GCAGC 1 cut(s) 143
MboII GAAGA 4 cut(s) 14, 35, 62, 101
PkrI GCNGC 1 cut(s) 133
PstI CTGCAG 1 cut(s) 133
SatI GCNGC 1 cut(s) 132
SetI ASST 3 cut(s) 13, 95, 140
SfcI CTRYAG 1 cut(s) 129
SgeI CNNG 8 cut(s) 17, 38, 49, 75, 90, 132, 140, 151
SmlI CTYRAG 1 cut(s) 118
SmoI CTYRAG 1 cut(s) 118
TaaI ACNGT 1 cut(s) 81
TseI GCWGC 1 cut(s) 131
TspDTI ATGAA 1 cut(s) 62
XagI CCTNNNNNAGG 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.