Rh6DG331900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
53711659 .. 53711973
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG331900.1

Sequence Viewer

Length: 315 bp
ATGAAACCAAAAGCAAGGACTTCAGTTTTCTTTCTTGCTAATCATGAGATTGCTTTTCCATCTTGCAGACACAATTTTGAAGAAAAGCATCGCAGACGCTATTTGAACCATCACTTGCCAGAGGTAGTCTTATCTTTACAAAATGTTGCTACTTGGCCACGTATTTATCTAGGAGTGAATAGGCATGTTCCATCCTTTATAGAAGTTGATCTATCCCTCCAACATTTCTGCCACTATCTTGTGTCAGGTAATAGGAACCAGACGACCCCCATCTCCCTTTCATTTGTGTGGCTGCAGTCTAGTGATCGAAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

12.32

Weight (kDa)

10.02

Isoelectric Point (pI)

71.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 155
AcuI CTGAAG 1 cut(s) 6
AgsI TTSAA 2 cut(s) 80, 106
AoxI GGCC 1 cut(s) 155
ApeKI GCWGC 1 cut(s) 292
BalI TGGCCA 1 cut(s) 157
BbvI GCAGC 1 cut(s) 279
BccI CCATC 4 cut(s) 67, 117, 199, 278
BfaI CTAG 2 cut(s) 170, 300
BfmI CTRYAG 1 cut(s) 293
BisI GCNGC 1 cut(s) 293
BlsI GCNGC 1 cut(s) 294
BmiI GGNNCC 1 cut(s) 257
BmsI GCATC 1 cut(s) 97
BsaAI YACGTR 1 cut(s) 161
BseGI GGATG 1 cut(s) 191
BseXI GCAGC 1 cut(s) 279
BshFI GGCC 1 cut(s) 157
BsnI GGCC 1 cut(s) 157
Bsp143I GATC 2 cut(s) 208, 304
BspANI GGCC 1 cut(s) 157
BspHI TCATGA 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 257
BspMAI CTGCAG 1 cut(s) 297
BssMI GATC 2 cut(s) 208, 304
BstBAI YACGTR 1 cut(s) 161
BstF5I GGATG 1 cut(s) 191
BstKTI GATC 2 cut(s) 211, 307
BstMBI GATC 2 cut(s) 208, 304
BstNSI RCATGY 1 cut(s) 188
BstSFI CTRYAG 1 cut(s) 293
BstV1I GCAGC 1 cut(s) 279
BsuRI GGCC 1 cut(s) 157
BtgZI GCGATG 1 cut(s) 74
BtsCI GGATG 1 cut(s) 191
CciI TCATGA 1 cut(s) 43
CseI GACGC 1 cut(s) 105
CviAII CATG 2 cut(s) 44, 185
CviJI RGCY 2 cut(s) 157, 292
CviKI_1 RGCY 2 cut(s) 157, 292
DpnI GATC 2 cut(s) 210, 306
DpnII GATC 2 cut(s) 208, 304
EaeI YGGCCR 1 cut(s) 155
Eco57I CTGAAG 1 cut(s) 6
FaeI CATG 2 cut(s) 47, 188
FaiI YATR 3 cut(s) 45, 186, 200
FatI CATG 2 cut(s) 43, 184
Fnu4HI GCNGC 1 cut(s) 293
FokI GGATG 1 cut(s) 178
Fsp4HI GCNGC 1 cut(s) 293
FspBI CTAG 2 cut(s) 170, 300
GluI GCNGC 1 cut(s) 293
HaeIII GGCC 1 cut(s) 157
HgaI GACGC 1 cut(s) 105
Hin1II CATG 2 cut(s) 47, 188
Hpy188III TCNNGA 1 cut(s) 44
HpyAV CCTTC 1 cut(s) 303
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 2 cut(s) 66, 295
HpySE526I ACGT 1 cut(s) 160
Hsp92II CATG 2 cut(s) 47, 188
Kzo9I GATC 2 cut(s) 208, 304
LpnPI CCDG 3 cut(s) 132, 231, 272
Lsp1109I GCAGC 1 cut(s) 279
LweI GCATC 1 cut(s) 97
MaeI CTAG 2 cut(s) 170, 300
MaeII ACGT 1 cut(s) 160
MalI GATC 2 cut(s) 210, 306
MboI GATC 2 cut(s) 208, 304
MboII GAAGA 1 cut(s) 92
MlsI TGGCCA 1 cut(s) 157
MluCI AATT 1 cut(s) 73
MluNI TGGCCA 1 cut(s) 157
MmeI TCCRAC 1 cut(s) 244
MnlI CCTC 2 cut(s) 115, 227
Mox20I TGGCCA 1 cut(s) 157
MscI TGGCCA 1 cut(s) 157
MslI CAYNNNNRTG 1 cut(s) 286
Msp20I TGGCCA 1 cut(s) 157
NdeII GATC 2 cut(s) 208, 304
NlaIII CATG 2 cut(s) 47, 188
NlaIV GGNNCC 1 cut(s) 257
NspI RCATGY 1 cut(s) 188
PagI TCATGA 1 cut(s) 43
PkrI GCNGC 1 cut(s) 294
Ppu21I YACGTR 1 cut(s) 161
PspN4I GGNNCC 1 cut(s) 257
PstI CTGCAG 1 cut(s) 297
RseI CAYNNNNRTG 1 cut(s) 286
SatI GCNGC 1 cut(s) 293
Sau3AI GATC 2 cut(s) 208, 304
SetI ASST 4 cut(s) 126, 163, 250, 314
SfaNI GCATC 1 cut(s) 97
SfcI CTRYAG 1 cut(s) 293
SmiMI CAYNNNNRTG 1 cut(s) 286
Sse9I AATT 1 cut(s) 73
SspMI CTAG 2 cut(s) 170, 300
TaiI ACGT 1 cut(s) 163
TaqI TCGA 1 cut(s) 307
TasI AATT 1 cut(s) 73
TseI GCWGC 1 cut(s) 292
TspDTI ATGAA 2 cut(s) 17, 270
XceI RCATGY 1 cut(s) 188
XspI CTAG 2 cut(s) 170, 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.