RchiOBHm_Chr6g0253611

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
8732348 .. 8733689
1342 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22742

Sequence Viewer

Length: 186 bp
ATGAGAATTCACTCGCTCACACATGGTATATCTTCACCTCTATCTCAAAAGTCCAAGTCAGTTAGCAACGACAAAGAAGCAAACAATAACTTGGTCTCATGTGTGTCAGAGGTAAGTGAACTTTTAAAGTTGCAAAATGAGAACTCTTATTGGCATGTTTGTTATCTTAGATTTTGTTTGAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.99

Weight (kDa)

8.57

Isoelectric Point (pI)

44.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 6
Alw26I GTCTC 1 cut(s) 100
ApoI RAATTY 1 cut(s) 6
AsuHPI GGTGA 1 cut(s) 27
BcoDI GTCTC 1 cut(s) 100
BsaI GGTCTC 1 cut(s) 100
BsmAI GTCTC 1 cut(s) 100
Bso31I GGTCTC 1 cut(s) 100
BspTNI GGTCTC 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 167
BstMAI GTCTC 1 cut(s) 100
BstNSI RCATGY 1 cut(s) 158
CviAII CATG 3 cut(s) 23, 99, 155
DdeI CTNAG 1 cut(s) 167
DraI TTTAAA 1 cut(s) 126
Eco31I GGTCTC 1 cut(s) 100
EcoRI GAATTC 1 cut(s) 6
FaeI CATG 3 cut(s) 26, 102, 158
FaiI YATR 4 cut(s) 24, 29, 100, 156
FatI CATG 3 cut(s) 22, 98, 154
FspEI CC 7 cut(s) 9, 51, 67, 77, 95, 136, 166
Hin1II CATG 3 cut(s) 26, 102, 158
HphI GGTGA 1 cut(s) 27
Hpy166II GTNNAC 1 cut(s) 119
Hpy188I TCNGA 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 119
HpyCH4V TGCA 1 cut(s) 133
HpyF3I CTNAG 1 cut(s) 167
Hsp92II CATG 3 cut(s) 26, 102, 158
MboII GAAGA 1 cut(s) 24
MluCI AATT 1 cut(s) 6
MnlI CCTC 3 cut(s) 48, 103, 174
MseI TTAA 1 cut(s) 125
NlaIII CATG 3 cut(s) 26, 102, 158
NspI RCATGY 1 cut(s) 158
SaqAI TTAA 1 cut(s) 125
SetI ASST 3 cut(s) 40, 114, 185
SgeI CNNG 6 cut(s) 25, 35, 67, 103, 111, 167
Sse9I AATT 1 cut(s) 6
TasI AATT 1 cut(s) 6
Tru1I TTAA 1 cut(s) 125
Tru9I TTAA 1 cut(s) 125
XapI RAATTY 1 cut(s) 6
XceI RCATGY 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.