RchiOBHm_Chr6g0272601

Protein of unknown function (DUF679)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0011601
Physical Location & Seq
Reverse (-)
32972305 .. 32972922
618 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24456

Sequence Viewer

Length: 411 bp
ATGGATGACTCTATCAACCATGGCCTAATTGATAGCAGTGAACATGGTGATGGTGATCTTTACTTGTGCTTTAAAGATGATGACACTGATGAATCCCATTCCACATTTCGGGGAATTTGGACTTTCAATGGTGATCGGAGGAAGCTTTGCGTTCCATCTGATTATAGGCTGAGATGGGCTGATCTCTTCCATGCATCACCTTCTCTGGTTGCATTTCTAACATTTGCAGGTTCACATAATGAGGTAGTGGGTTGTTATTATCCAGCAATGCCTAAGAGGATCACCAACAACCTACCTCTGGTGATTGGGTTTGTAGTTTCTTTCTTCCTTGTGTTGTTTCCTTCCAAGAGAAGGGGAATTGGTTATCCTTTCTTGCTGATGAGAGATGCTTTGTACTCTAGACGTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF679

Protein Analysis

136

Amino Acids

15.55

Weight (kDa)

6.49

Isoelectric Point (pI)

53.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF679 PF05078 34 - 122 2.4e-24 Protein of unknown function (DUF679)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 218
AclWI GGATC 1 cut(s) 287
AcsI RAATTY 1 cut(s) 114
AfaI GTAC 1 cut(s) 395
AfiI CCNNNNNNNGG 3 cut(s) 108, 298, 351
AgsI TTSAA 1 cut(s) 127
AluBI AGCT 1 cut(s) 145
AluI AGCT 1 cut(s) 145
AlwI GGATC 1 cut(s) 287
AoxI GGCC 1 cut(s) 22
ApoI RAATTY 1 cut(s) 114
AsuHPI GGTGA 6 cut(s) 59, 65, 143, 189, 274, 313
BccI CCATC 3 cut(s) 44, 163, 168
BfaI CTAG 1 cut(s) 399
BfuAI ACCTGC 1 cut(s) 218
BmsI GCATC 2 cut(s) 203, 376
BsaBI GATNNNNATC 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 19
Bsc4I CCNNNNNNNGG 3 cut(s) 108, 298, 351
Bse3DI GCAATG 1 cut(s) 273
Bse8I GATNNNNATC 1 cut(s) 54
BseDI CCNNGG 1 cut(s) 19
BseGI GGATG 1 cut(s) 10
BseJI GATNNNNATC 1 cut(s) 54
BseLI CCNNNNNNNGG 3 cut(s) 108, 298, 351
BseMI GCAATG 1 cut(s) 273
BseMII CTCAG 1 cut(s) 161
BshFI GGCC 1 cut(s) 24
BslI CCNNNNNNNGG 3 cut(s) 108, 298, 351
BsnI GGCC 1 cut(s) 24
Bsp143I GATC 4 cut(s) 55, 133, 181, 279
Bsp19I CCATGG 1 cut(s) 19
BspANI GGCC 1 cut(s) 24
BspCNI CTCAG 1 cut(s) 162
BspMI ACCTGC 1 cut(s) 218
BspPI GGATC 1 cut(s) 287
BsrDI GCAATG 1 cut(s) 273
BssECI CCNNGG 1 cut(s) 19
BssMI GATC 4 cut(s) 55, 133, 181, 279
BssT1I CCWWGG 1 cut(s) 19
Bst6I CTCTTC 1 cut(s) 191
BstDEI CTNAG 2 cut(s) 170, 273
BstDSI CCRYGG 1 cut(s) 19
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 4 cut(s) 58, 136, 184, 282
BstMBI GATC 4 cut(s) 55, 133, 181, 279
BsuRI GGCC 1 cut(s) 24
BtgI CCRYGG 1 cut(s) 19
BtsCI GGATG 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 43
BtsIMutI CAGTG 2 cut(s) 43, 84
BveI ACCTGC 1 cut(s) 218
Csp6I GTAC 1 cut(s) 394
CviAII CATG 3 cut(s) 20, 44, 191
CviJI RGCY 4 cut(s) 24, 145, 169, 179
CviKI_1 RGCY 4 cut(s) 24, 145, 169, 179
CviQI GTAC 1 cut(s) 394
DdeI CTNAG 2 cut(s) 170, 273
DpnI GATC 4 cut(s) 57, 135, 183, 281
DpnII GATC 4 cut(s) 55, 133, 181, 279
DraI TTTAAA 1 cut(s) 73
Eam1104I CTCTTC 1 cut(s) 191
EarI CTCTTC 1 cut(s) 191
Eco130I CCWWGG 1 cut(s) 19
EcoT14I CCWWGG 1 cut(s) 19
EcoT22I ATGCAT 1 cut(s) 196
ErhI CCWWGG 1 cut(s) 19
FaeI CATG 3 cut(s) 23, 47, 194
FaiI YATR 6 cut(s) 21, 45, 165, 192, 237, 409
FatI CATG 3 cut(s) 19, 43, 190
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 399
HaeIII GGCC 1 cut(s) 24
Hin1II CATG 3 cut(s) 23, 47, 194
HindIII AAGCTT 1 cut(s) 143
HinfI GANTC 2 cut(s) 8, 92
HphI GGTGA 6 cut(s) 59, 65, 143, 189, 274, 313
Hpy166II GTNNAC 2 cut(s) 41, 233
Hpy188I TCNGA 2 cut(s) 138, 160
Hpy188III TCNNGA 1 cut(s) 399
Hpy8I GTNNAC 2 cut(s) 41, 233
HpyAV CCTTC 3 cut(s) 210, 345, 351
HpyCH4IV ACGT 1 cut(s) 403
HpyCH4V TGCA 3 cut(s) 194, 212, 227
HpyF3I CTNAG 2 cut(s) 170, 273
HpySE526I ACGT 1 cut(s) 403
Hsp92II CATG 3 cut(s) 23, 47, 194
Kzo9I GATC 4 cut(s) 55, 133, 181, 279
LpnPI CCDG 4 cut(s) 191, 213, 276, 284
LweI GCATC 2 cut(s) 203, 376
MaeI CTAG 1 cut(s) 399
MaeII ACGT 1 cut(s) 403
MalI GATC 4 cut(s) 57, 135, 183, 281
MboI GATC 4 cut(s) 55, 133, 181, 279
MboII GAAGA 2 cut(s) 178, 316
MluCI AATT 3 cut(s) 27, 114, 357
MlyI GAGTC 1 cut(s) 2
MnlI CCTC 4 cut(s) 132, 235, 270, 306
Mph1103I ATGCAT 1 cut(s) 196
MseI TTAA 1 cut(s) 72
MslI CAYNNNNRTG 1 cut(s) 48
NcoI CCATGG 1 cut(s) 19
NdeII GATC 4 cut(s) 55, 133, 181, 279
NlaIII CATG 3 cut(s) 23, 47, 194
NsiI ATGCAT 1 cut(s) 196
PfeI GAWTC 1 cut(s) 92
PleI GAGTC 1 cut(s) 2
PpsI GAGTC 1 cut(s) 2
RsaI GTAC 1 cut(s) 395
RsaNI GTAC 1 cut(s) 394
RseI CAYNNNNRTG 1 cut(s) 48
SaqAI TTAA 1 cut(s) 72
Sau3AI GATC 4 cut(s) 55, 133, 181, 279
SchI GAGTC 1 cut(s) 2
SetI ASST 7 cut(s) 147, 202, 232, 246, 294, 298, 406
SfaNI GCATC 2 cut(s) 203, 376
SmiMI CAYNNNNRTG 1 cut(s) 48
Sse9I AATT 3 cut(s) 27, 114, 357
SspMI CTAG 1 cut(s) 399
StyI CCWWGG 1 cut(s) 19
TaiI ACGT 1 cut(s) 406
TasI AATT 3 cut(s) 27, 114, 357
TatI WGTACW 1 cut(s) 393
TfiI GAWTC 1 cut(s) 92
Tru1I TTAA 1 cut(s) 72
Tru9I TTAA 1 cut(s) 72
TscAI CASTG 2 cut(s) 43, 91
TspDTI ATGAA 2 cut(s) 105, 396
TspRI CASTG 2 cut(s) 43, 91
XapI RAATTY 1 cut(s) 114
XbaI TCTAGA 1 cut(s) 398
XspI CTAG 1 cut(s) 399
Zsp2I ATGCAT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.