RLG00000002295

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Forward (+)
31776079 .. 31777288
1210 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000002295

Sequence Viewer

Length: 306 bp
ATGGGTCTTGCGGGGGATGCATGTAAGGTGTTTGATAGAATGCCTAAGAGGAATTCAGTTTCGTGGGCTACTGTGATTTCTGGGTATGCAATGCAACGCCTAGCTGGAGATGTGTTAGAGCTTCTTAGGTTGATGCGTAGAGGTGAGGAGAATGAGGGAGAGAATGAGTTTATTTTGAGTAGTGTTTTGACACAACCTCCCAAAGTAAAGCATGAGACATTATTTACAGGAAAAAATTTATGGGTAAGGCTGATATGTACCAAGAAGCTCAACTCCAATGATGCAGTTGTGACAAGACGGAGCTGA

Protein Analysis

102

Amino Acids

11.39

Weight (kDa)

9.62

Isoelectric Point (pI)

46.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AcsI RAATTY 2 cut(s) 52, 235
AfaI GTAC 1 cut(s) 259
AluBI AGCT 4 cut(s) 104, 121, 268, 303
AluI AGCT 4 cut(s) 104, 121, 268, 303
Alw26I GTCTC 1 cut(s) 209
ApoI RAATTY 2 cut(s) 52, 235
AsuHPI GGTGA 1 cut(s) 155
BcoDI GTCTC 1 cut(s) 209
BfaI CTAG 1 cut(s) 101
BmsI GCATC 3 cut(s) 7, 123, 271
BpmI CTGGAG 1 cut(s) 126
BsaXI ACNNNNNCTCC 2 cut(s) 181, 211
Bse3DI GCAATG 1 cut(s) 96
BseGI GGATG 1 cut(s) 22
BseMI GCAATG 1 cut(s) 96
BseRI GAGGAG 1 cut(s) 161
BsmAI GTCTC 1 cut(s) 209
BsmI GAATGC 1 cut(s) 45
BspACI CCGC 1 cut(s) 11
BsrDI GCAATG 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 73
BstDEI CTNAG 2 cut(s) 45, 125
BstF5I GGATG 1 cut(s) 22
BstMAI GTCTC 1 cut(s) 209
BstMWI GCNNNNNNNGC 1 cut(s) 17
BstNSI RCATGY 1 cut(s) 24
BtsCI GGATG 1 cut(s) 22
Csp6I GTAC 1 cut(s) 258
CviAII CATG 2 cut(s) 21, 212
CviJI RGCY 6 cut(s) 68, 104, 121, 250, 268, 303
CviKI_1 RGCY 6 cut(s) 68, 104, 121, 250, 268, 303
CviQI GTAC 1 cut(s) 258
DdeI CTNAG 2 cut(s) 45, 125
EcoRI GAATTC 1 cut(s) 52
EcoT22I ATGCAT 1 cut(s) 22
FaeI CATG 2 cut(s) 24, 215
FaiI YATR 5 cut(s) 22, 87, 213, 241, 256
FatI CATG 2 cut(s) 20, 211
FauI CCCGC 1 cut(s) 4
FokI GGATG 1 cut(s) 29
FspBI CTAG 1 cut(s) 101
GsuI CTGGAG 1 cut(s) 126
Hin1II CATG 2 cut(s) 24, 215
HphI GGTGA 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4V TGCA 4 cut(s) 20, 89, 94, 284
HpyF10VI GCNNNNNNNGC 1 cut(s) 17
HpyF3I CTNAG 2 cut(s) 45, 125
Hsp92II CATG 2 cut(s) 24, 215
LmnI GCTCC 1 cut(s) 300
LpnPI CCDG 3 cut(s) 66, 90, 213
LweI GCATC 3 cut(s) 7, 123, 271
MaeI CTAG 1 cut(s) 101
MaeIII GTNAC 1 cut(s) 289
MluCI AATT 2 cut(s) 52, 235
MnlI CCTC 5 cut(s) 42, 134, 139, 148, 207
Mph1103I ATGCAT 1 cut(s) 22
Mva1269I GAATGC 1 cut(s) 45
MwoI GCNNNNNNNGC 1 cut(s) 17
NlaIII CATG 2 cut(s) 24, 215
NmuCI GTSAC 1 cut(s) 289
NsiI ATGCAT 1 cut(s) 22
NspI RCATGY 1 cut(s) 24
PctI GAATGC 1 cut(s) 45
RsaI GTAC 1 cut(s) 259
RsaNI GTAC 1 cut(s) 258
SetI ASST 8 cut(s) 30, 106, 123, 131, 145, 199, 270, 305
SfaNI GCATC 3 cut(s) 7, 123, 271
Sse9I AATT 2 cut(s) 52, 235
SsiI CCGC 1 cut(s) 11
SspMI CTAG 1 cut(s) 101
TaaI ACNGT 1 cut(s) 73
TasI AATT 2 cut(s) 52, 235
TseFI GTSAC 1 cut(s) 289
Tsp45I GTSAC 1 cut(s) 289
XapI RAATTY 2 cut(s) 52, 235
XceI RCATGY 1 cut(s) 24
XspI CTAG 1 cut(s) 101
Zsp2I ATGCAT 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.