Rh3CG363800

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
45608611 .. 45608817
207 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG363800.1

Sequence Viewer

Length: 207 bp
ATGCAATGCTTGGCTGGAGATGCGTTGGATCTTCTCAGGTTGATGCGTAGAGGTGAGGAGAGTGAGGGAGAGAATGAGTTTATTTTGACTAGTGTTGTGAGTGCCTTGGCTGTTCCTGAGTTTGTTGATACGGGGAAGCAAGACTTGAGGCGAGGTAAGAGGAGAATGACCTTGGAGAGCTTTGGCAAGGCCAAGGTGCTGATCTGA

Protein Analysis

68

Amino Acids

7.6

Weight (kDa)

6.22

Isoelectric Point (pI)

57.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 36
AhlI ACTAGT 1 cut(s) 89
AluBI AGCT 1 cut(s) 180
AluI AGCT 1 cut(s) 180
AlwI GGATC 1 cut(s) 36
AoxI GGCC 1 cut(s) 189
AsuHPI GGTGA 1 cut(s) 65
BcuI ACTAGT 1 cut(s) 89
BfaI CTAG 1 cut(s) 90
BmsI GCATC 2 cut(s) 10, 33
BpmI CTGGAG 1 cut(s) 36
BpuEI CTTGAG 1 cut(s) 166
BsaJI CCNNGG 3 cut(s) 105, 171, 192
Bse3DI GCAATG 1 cut(s) 11
BseDI CCNNGG 3 cut(s) 105, 171, 192
BseMI GCAATG 1 cut(s) 11
BseMII CTCAG 2 cut(s) 49, 108
BseRI GAGGAG 2 cut(s) 71, 175
BshFI GGCC 1 cut(s) 191
BsnI GGCC 1 cut(s) 191
Bsp143I GATC 2 cut(s) 28, 201
BspANI GGCC 1 cut(s) 191
BspCNI CTCAG 2 cut(s) 48, 109
BspPI GGATC 1 cut(s) 36
BsrDI GCAATG 1 cut(s) 11
BssECI CCNNGG 3 cut(s) 105, 171, 192
BssMI GATC 2 cut(s) 28, 201
BssT1I CCWWGG 3 cut(s) 105, 171, 192
BstDEI CTNAG 2 cut(s) 35, 117
BstKTI GATC 2 cut(s) 31, 204
BstMBI GATC 2 cut(s) 28, 201
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstX2I RGATCY 1 cut(s) 28
BstYI RGATCY 1 cut(s) 28
BsuRI GGCC 1 cut(s) 191
CviJI RGCY 4 cut(s) 14, 110, 180, 191
CviKI_1 RGCY 4 cut(s) 14, 110, 180, 191
DdeI CTNAG 2 cut(s) 35, 117
DpnI GATC 2 cut(s) 30, 203
DpnII GATC 2 cut(s) 28, 201
Eco130I CCWWGG 3 cut(s) 105, 171, 192
EcoT14I CCWWGG 3 cut(s) 105, 171, 192
ErhI CCWWGG 3 cut(s) 105, 171, 192
FalI AAGNNNNNCTT 2 cut(s) 128, 160
FspBI CTAG 1 cut(s) 90
GsuI CTGGAG 1 cut(s) 36
HaeIII GGCC 1 cut(s) 191
HphI GGTGA 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 206
Hpy188III TCNNGA 1 cut(s) 116
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
HpyF3I CTNAG 2 cut(s) 35, 117
Kzo9I GATC 2 cut(s) 28, 201
LpnPI CCDG 2 cut(s) 22, 129
LweI GCATC 2 cut(s) 10, 33
MaeI CTAG 1 cut(s) 90
MalI GATC 2 cut(s) 30, 203
MboI GATC 2 cut(s) 28, 201
MboII GAAGA 1 cut(s) 23
MflI RGATCY 1 cut(s) 28
MmeI TCCRAC 1 cut(s) 6
MnlI CCTC 6 cut(s) 44, 49, 58, 141, 146, 153
MwoI GCNNNNNNNGC 1 cut(s) 20
NdeII GATC 2 cut(s) 28, 201
PsuI RGATCY 1 cut(s) 28
Sau3AI GATC 2 cut(s) 28, 201
SetI ASST 6 cut(s) 41, 55, 157, 173, 182, 198
SfaNI GCATC 2 cut(s) 10, 33
SmlI CTYRAG 1 cut(s) 145
SmoI CTYRAG 1 cut(s) 145
SpeI ACTAGT 1 cut(s) 89
SspMI CTAG 1 cut(s) 90
StyI CCWWGG 3 cut(s) 105, 171, 192
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.