Rh6CG292100

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
46976303 .. 46976500
198 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG292100.1

Sequence Viewer

Length: 198 bp
ATGCAACGCCTGGCTGGAGATGCATTGGAGCTTCTCGGGTTGATGCGTAGAGGTGAGGGAGAGAATGAGTTTATTTTGACTAGTGTTGTGAGTGCCTTGGCTGTTCCTGAGTTTGTTGATACGGGGAAGCAAGACTTGAGGCGAGGTAAGAGGAGAATGACCTTGGAGAGCTCTGGCAAGGCCAAGGTGCTGGTCTGA

Protein Analysis

65

Amino Acids

7.15

Weight (kDa)

9.51

Isoelectric Point (pI)

46.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AhlI ACTAGT 1 cut(s) 80
AjnI CCWGG 1 cut(s) 9
AluBI AGCT 2 cut(s) 31, 171
AluI AGCT 2 cut(s) 31, 171
Alw21I GWGCWC 1 cut(s) 173
Ama87I CYCGRG 1 cut(s) 35
AoxI GGCC 1 cut(s) 180
AsuHPI GGTGA 1 cut(s) 65
AvaI CYCGRG 1 cut(s) 35
BanII GRGCYC 1 cut(s) 173
Bbv12I GWGCWC 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 11
BcuI ACTAGT 1 cut(s) 80
BfaI CTAG 1 cut(s) 81
Bme1390I CCNGG 1 cut(s) 11
BmeT110I CYCGRG 1 cut(s) 35
BmrFI CCNGG 1 cut(s) 11
BmsI GCATC 2 cut(s) 10, 33
BpmI CTGGAG 1 cut(s) 36
BpuEI CTTGAG 1 cut(s) 157
BsaJI CCNNGG 3 cut(s) 96, 162, 183
BseBI CCWGG 1 cut(s) 11
BseDI CCNNGG 3 cut(s) 96, 162, 183
BseMII CTCAG 1 cut(s) 99
BseRI GAGGAG 1 cut(s) 166
BshFI GGCC 1 cut(s) 182
BsiHKAI GWGCWC 1 cut(s) 173
BsiHKCI CYCGRG 1 cut(s) 35
BsnI GGCC 1 cut(s) 182
BsoBI CYCGRG 1 cut(s) 35
Bsp1286I GDGCHC 1 cut(s) 173
BspANI GGCC 1 cut(s) 182
BspCNI CTCAG 1 cut(s) 100
BssECI CCNNGG 3 cut(s) 96, 162, 183
BssT1I CCWWGG 3 cut(s) 96, 162, 183
Bst2UI CCWGG 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 108
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstNI CCWGG 1 cut(s) 11
BstSCI CCNGG 1 cut(s) 9
BstXI CCANNNNNNTGG 1 cut(s) 190
BsuRI GGCC 1 cut(s) 182
CviJI RGCY 5 cut(s) 14, 31, 101, 171, 182
CviKI_1 RGCY 5 cut(s) 14, 31, 101, 171, 182
DdeI CTNAG 1 cut(s) 108
Ecl136II GAGCTC 1 cut(s) 171
Eco130I CCWWGG 3 cut(s) 96, 162, 183
Eco24I GRGCYC 1 cut(s) 173
Eco53kI GAGCTC 1 cut(s) 171
Eco88I CYCGRG 1 cut(s) 35
EcoICRI GAGCTC 1 cut(s) 171
EcoRII CCWGG 1 cut(s) 9
EcoT14I CCWWGG 3 cut(s) 96, 162, 183
EcoT22I ATGCAT 1 cut(s) 25
EcoT38I GRGCYC 1 cut(s) 173
ErhI CCWWGG 3 cut(s) 96, 162, 183
FalI AAGNNNNNCTT 2 cut(s) 119, 151
FriOI GRGCYC 1 cut(s) 173
FspBI CTAG 1 cut(s) 81
GsuI CTGGAG 1 cut(s) 36
HaeIII GGCC 1 cut(s) 182
HphI GGTGA 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 197
Hpy188III TCNNGA 1 cut(s) 107
HpyCH4V TGCA 2 cut(s) 4, 23
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
HpyF3I CTNAG 1 cut(s) 108
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 4 cut(s) 23, 120, 159, 176
LweI GCATC 2 cut(s) 10, 33
MaeI CTAG 1 cut(s) 81
MhlI GDGCHC 1 cut(s) 173
MnlI CCTC 5 cut(s) 44, 49, 132, 137, 144
Mph1103I ATGCAT 1 cut(s) 25
MspR9I CCNGG 1 cut(s) 11
MvaI CCWGG 1 cut(s) 11
MwoI GCNNNNNNNGC 1 cut(s) 20
NsiI ATGCAT 1 cut(s) 25
Psp124BI GAGCTC 1 cut(s) 173
Psp6I CCWGG 1 cut(s) 9
PspGI CCWGG 1 cut(s) 9
SacI GAGCTC 1 cut(s) 173
ScrFI CCNGG 1 cut(s) 11
SduI GDGCHC 1 cut(s) 173
SetI ASST 6 cut(s) 33, 55, 148, 164, 173, 189
SfaNI GCATC 2 cut(s) 10, 33
SmlI CTYRAG 1 cut(s) 136
SmoI CTYRAG 1 cut(s) 136
SpeI ACTAGT 1 cut(s) 80
SspMI CTAG 1 cut(s) 81
SstI GAGCTC 1 cut(s) 173
StyD4I CCNGG 1 cut(s) 9
StyI CCWWGG 3 cut(s) 96, 162, 183
XspI CTAG 1 cut(s) 81
Zsp2I ATGCAT 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.