Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002129.1

Orthogroup ID

OG0010619

Physical Location & Seq

Genomic Coordinates Reverse (-)

80023 .. 80319

Gene Structure 297 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002129.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

atgggtcttgtgggggatgcacgtaaggtgtttgatagaattcctgagaggaattcagtttcgtgggctactatgatttttgggtatgcaatgcaatgcttagctggagatgcgttggagcttctggggttgatgcgtagaggtgaggagagtgagggagagagtgagtttattttgactagtgttgtgagtgccttggctgttcctgagtttgttgatacggggaagcaagacttgaggcgaggtaagaggagaatgaccttggagagctctggcaaggccaaggtgctgatctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

98

Amino Acids

10.79

Weight (kDa)

6.28

Isoelectric Point (pI)

48.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010619)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0095201 RchiOBHm_Chr6g0285881
rosa_laevigata	RLG00000000751 RLG00000002295 RLG00000010237 RLG00000025502
rosa_multiflora	Rmu_sc0002129.1_g000014
rosa_roxburghii	Rroxscaffold_1G00028370 Rroxscaffold_5G00349650
rosa_rugosa	Rorug02G0529200
rosa_samantha	Rh1DG087100 Rh2AG140000 Rh2BG143400 Rh2DG097800 Rh3CG363800 Rh3DG316300 Rh4AG097200 Rh4CG106500 Rh6CG292100 Rh6DG284200 Rh7CG172400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	39, 52
AhlI	ACTAGT	1 cut(s)	179
AluBI	AGCT	3 cut(s)	104, 121, 270
AluI	AGCT	3 cut(s)	104, 121, 270
Alw21I	GWGCWC	1 cut(s)	272
AoxI	GGCC	1 cut(s)	279
ApoI	RAATTY	2 cut(s)	39, 52
AsuHPI	GGTGA	1 cut(s)	155
BanII	GRGCYC	1 cut(s)	272
Bbv12I	GWGCWC	1 cut(s)	272
BcuI	ACTAGT	1 cut(s)	179
BfaI	CTAG	1 cut(s)	180
BlpI	GCTNAGC	1 cut(s)	100
BmsI	GCATC	3 cut(s)	7, 100, 123
BpmI	CTGGAG	1 cut(s)	126
Bpu1102I	GCTNAGC	1 cut(s)	100
BpuEI	CTTGAG	1 cut(s)	256
BsaAI	YACGTR	1 cut(s)	23
BsaJI	CCNNGG	3 cut(s)	195, 261, 282
Bse3DI	GCAATG	2 cut(s)	96, 101
BseDI	CCNNGG	3 cut(s)	195, 261, 282
BseGI	GGATG	1 cut(s)	22
BseMI	GCAATG	2 cut(s)	96, 101
BseMII	CTCAG	2 cut(s)	36, 198
BseRI	GAGGAG	2 cut(s)	161, 265
BshFI	GGCC	1 cut(s)	281
BsiHKAI	GWGCWC	1 cut(s)	272
BsnI	GGCC	1 cut(s)	281
Bsp1286I	GDGCHC	1 cut(s)	272
Bsp143I	GATC	1 cut(s)	291
Bsp1720I	GCTNAGC	1 cut(s)	100
BspANI	GGCC	1 cut(s)	281
BspCNI	CTCAG	2 cut(s)	37, 199
BsrDI	GCAATG	2 cut(s)	96, 101
BssECI	CCNNGG	3 cut(s)	195, 261, 282
BssMI	GATC	1 cut(s)	291
BssT1I	CCWWGG	3 cut(s)	195, 261, 282
BstBAI	YACGTR	1 cut(s)	23
BstDEI	CTNAG	3 cut(s)	45, 100, 207
BstF5I	GGATG	1 cut(s)	22
BstKTI	GATC	1 cut(s)	294
BstMBI	GATC	1 cut(s)	291
BstMWI	GCNNNNNNNGC	1 cut(s)	110
BsuRI	GGCC	1 cut(s)	281
BtsCI	GGATG	1 cut(s)	22
CviJI	RGCY	6 cut(s)	68, 104, 121, 200, 270, 281
CviKI_1	RGCY	6 cut(s)	68, 104, 121, 200, 270, 281
DdeI	CTNAG	3 cut(s)	45, 100, 207
DpnI	GATC	1 cut(s)	293
DpnII	GATC	1 cut(s)	291
Ecl136II	GAGCTC	1 cut(s)	270
Eco130I	CCWWGG	3 cut(s)	195, 261, 282
Eco24I	GRGCYC	1 cut(s)	272
Eco53kI	GAGCTC	1 cut(s)	270
EcoICRI	GAGCTC	1 cut(s)	270
EcoRI	GAATTC	2 cut(s)	39, 52
EcoT14I	CCWWGG	3 cut(s)	195, 261, 282
EcoT38I	GRGCYC	1 cut(s)	272
ErhI	CCWWGG	3 cut(s)	195, 261, 282
FaiI	YATR	2 cut(s)	74, 87
FalI	AAGNNNNNCTT	2 cut(s)	218, 250
FokI	GGATG	1 cut(s)	29
FriOI	GRGCYC	1 cut(s)	272
FspBI	CTAG	1 cut(s)	180
GsuI	CTGGAG	1 cut(s)	126
HaeIII	GGCC	1 cut(s)	281
HphI	GGTGA	1 cut(s)	155
Hpy188I	TCNGA	1 cut(s)	296
Hpy188III	TCNNGA	2 cut(s)	44, 206
HpyCH4IV	ACGT	1 cut(s)	22
HpyCH4V	TGCA	3 cut(s)	20, 89, 94
HpyF10VI	GCNNNNNNNGC	1 cut(s)	110
HpyF3I	CTNAG	3 cut(s)	45, 100, 207
HpySE526I	ACGT	1 cut(s)	22
Kzo9I	GATC	1 cut(s)	291
LmnI	GCTCC	1 cut(s)	118
LpnPI	CCDG	5 cut(s)	57, 90, 110, 219, 258
LweI	GCATC	3 cut(s)	7, 100, 123
MaeI	CTAG	1 cut(s)	180
MaeII	ACGT	1 cut(s)	22
MalI	GATC	1 cut(s)	293
MboI	GATC	1 cut(s)	291
MhlI	GDGCHC	1 cut(s)	272
MluCI	AATT	2 cut(s)	39, 52
MmeI	TCCRAC	1 cut(s)	96
MnlI	CCTC	7 cut(s)	42, 134, 139, 148, 231, 236, 243
MwoI	GCNNNNNNNGC	1 cut(s)	110
NdeII	GATC	1 cut(s)	291
Ppu21I	YACGTR	1 cut(s)	23
Psp124BI	GAGCTC	1 cut(s)	272
SacI	GAGCTC	1 cut(s)	272
Sau3AI	GATC	1 cut(s)	291
SduI	GDGCHC	1 cut(s)	272
SetI	ASST	9 cut(s)	25, 30, 106, 123, 145, 247, 263, 272, 288
SfaNI	GCATC	3 cut(s)	7, 100, 123
SmlI	CTYRAG	1 cut(s)	235
SmoI	CTYRAG	1 cut(s)	235
SpeI	ACTAGT	1 cut(s)	179
Sse9I	AATT	2 cut(s)	39, 52
SspMI	CTAG	1 cut(s)	180
SstI	GAGCTC	1 cut(s)	272
StyI	CCWWGG	3 cut(s)	195, 261, 282
TaiI	ACGT	1 cut(s)	25
TasI	AATT	2 cut(s)	39, 52
XapI	RAATTY	2 cut(s)	39, 52
XspI	CTAG	1 cut(s)	180

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.