RLG00000025502

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Reverse (-)
46234114 .. 46234471
358 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000025502

Sequence Viewer

Length: 315 bp
ATGGGTCTTGTGGGGGATGCACGTAAGGTGTTTGATAGAATGCTTGAGAGGAATTCGGTTTCGTGGGCTACTATGATTTATGGGTATGCAATGCAATGCCTGGCTGGAGATGCGTTAGAGCTTCTCGGGTTGATGCGTAGAGGTGAGGAGAGTGAGGGAGAGAATGAGTTTATTTTGACTAGTGTTGTGAATGCCTTGGCTGTTCCTGAGTTTGTTGATACGGGGAAGCAAGACTTGAGGCGAGGCCAAGGTGTTGATCTGAGGGTCAAGGGAGAGGAGGTGGGTGGAGATGGAGGAATGGGGAAAATTGTTTGA

Protein Analysis

105

Amino Acids

11.28

Weight (kDa)

4.69

Isoelectric Point (pI)

31.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 52
AhlI ACTAGT 1 cut(s) 179
AjnI CCWGG 1 cut(s) 99
AluBI AGCT 1 cut(s) 121
AluI AGCT 1 cut(s) 121
Ama87I CYCGRG 1 cut(s) 125
AoxI GGCC 1 cut(s) 244
ApoI RAATTY 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 155
AvaI CYCGRG 1 cut(s) 125
BccI CCATC 1 cut(s) 284
BciT130I CCWGG 1 cut(s) 101
BcuI ACTAGT 1 cut(s) 179
BfaI CTAG 1 cut(s) 180
Bme1390I CCNGG 1 cut(s) 101
BmeT110I CYCGRG 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 101
BmsI GCATC 3 cut(s) 7, 100, 123
BpmI CTGGAG 1 cut(s) 126
BpuEI CTTGAG 2 cut(s) 65, 256
BsaAI YACGTR 1 cut(s) 23
BsaJI CCNNGG 2 cut(s) 195, 247
BsaXI ACNNNNNCTCC 2 cut(s) 264, 294
Bse3DI GCAATG 2 cut(s) 96, 101
BseBI CCWGG 1 cut(s) 101
BseDI CCNNGG 2 cut(s) 195, 247
BseGI GGATG 1 cut(s) 22
BseMI GCAATG 2 cut(s) 96, 101
BseMII CTCAG 2 cut(s) 198, 251
BseRI GAGGAG 2 cut(s) 161, 290
BshFI GGCC 1 cut(s) 246
BsiHKCI CYCGRG 1 cut(s) 125
BsmI GAATGC 2 cut(s) 45, 196
BsnI GGCC 1 cut(s) 246
BsoBI CYCGRG 1 cut(s) 125
Bsp143I GATC 1 cut(s) 256
BspANI GGCC 1 cut(s) 246
BspCNI CTCAG 2 cut(s) 199, 252
BsrDI GCAATG 2 cut(s) 96, 101
BssECI CCNNGG 2 cut(s) 195, 247
BssMI GATC 1 cut(s) 256
BssT1I CCWWGG 2 cut(s) 195, 247
Bst2UI CCWGG 1 cut(s) 101
BstBAI YACGTR 1 cut(s) 23
BstDEI CTNAG 2 cut(s) 207, 260
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 1 cut(s) 259
BstMBI GATC 1 cut(s) 256
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstNI CCWGG 1 cut(s) 101
BstSCI CCNGG 1 cut(s) 99
BsuRI GGCC 1 cut(s) 246
BtsCI GGATG 1 cut(s) 22
CviJI RGCY 5 cut(s) 68, 104, 121, 200, 246
CviKI_1 RGCY 5 cut(s) 68, 104, 121, 200, 246
DdeI CTNAG 2 cut(s) 207, 260
DpnI GATC 1 cut(s) 258
DpnII GATC 1 cut(s) 256
Eco130I CCWWGG 2 cut(s) 195, 247
Eco88I CYCGRG 1 cut(s) 125
EcoRI GAATTC 1 cut(s) 52
EcoRII CCWGG 1 cut(s) 99
EcoT14I CCWWGG 2 cut(s) 195, 247
ErhI CCWWGG 2 cut(s) 195, 247
FaiI YATR 3 cut(s) 74, 81, 87
FalI AAGNNNNNCTT 2 cut(s) 218, 250
FokI GGATG 1 cut(s) 29
FspBI CTAG 1 cut(s) 180
GsuI CTGGAG 1 cut(s) 126
HaeIII GGCC 1 cut(s) 246
HphI GGTGA 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 261
Hpy188III TCNNGA 1 cut(s) 206
HpyCH4IV ACGT 1 cut(s) 22
HpyCH4V TGCA 3 cut(s) 20, 89, 94
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
HpyF3I CTNAG 2 cut(s) 207, 260
HpySE526I ACGT 1 cut(s) 22
Kzo9I GATC 1 cut(s) 256
LpnPI CCDG 4 cut(s) 86, 90, 113, 219
LweI GCATC 3 cut(s) 7, 100, 123
MaeI CTAG 1 cut(s) 180
MaeII ACGT 1 cut(s) 22
MalI GATC 1 cut(s) 258
MboI GATC 1 cut(s) 256
MluCI AATT 2 cut(s) 52, 306
MspR9I CCNGG 1 cut(s) 101
Mva1269I GAATGC 2 cut(s) 45, 196
MvaI CCWGG 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 110
NdeII GATC 1 cut(s) 256
PctI GAATGC 2 cut(s) 45, 196
Ppu21I YACGTR 1 cut(s) 23
Psp6I CCWGG 1 cut(s) 99
PspGI CCWGG 1 cut(s) 99
Sau3AI GATC 1 cut(s) 256
ScrFI CCNGG 1 cut(s) 101
SetI ASST 6 cut(s) 25, 30, 123, 145, 253, 282
SfaNI GCATC 3 cut(s) 7, 100, 123
SmlI CTYRAG 2 cut(s) 44, 235
SmoI CTYRAG 2 cut(s) 44, 235
SpeI ACTAGT 1 cut(s) 179
Sse9I AATT 2 cut(s) 52, 306
SspMI CTAG 1 cut(s) 180
StyD4I CCNGG 1 cut(s) 99
StyI CCWWGG 2 cut(s) 195, 247
TaiI ACGT 1 cut(s) 25
TasI AATT 2 cut(s) 52, 306
XapI RAATTY 1 cut(s) 52
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.