RLG00000008228

Plant protein of unknown function (DUF641)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0013759
Physical Location & Seq
Reverse (-)
27421208 .. 27421726
519 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000008228

Sequence Viewer

Length: 336 bp
ATGGCATTTGCAAGCTCAAGCCCAATGCCGAACGTGGACGAGCTGAAAGCCATTTTAGAGCTCAAATGCAGCTTCTTGAAGAAAGAGCTCGATCTCTCGCCGCAATTGACCCTAATGCTGGCGGAGATTCAAGAACAACAGGGCCTAATGAAGACATACGAGATCACGATCAAGGAGCCTGGAGCTCACCGCAAAGTGAAGCAAGAGTCGAAAGTGGAGATTGATTTGAATGACAATGATGAGGAAGAGGATGGTAGTGGGGATGTGAAAATGGATGATGTTCAGGGAGGAATTGCATACTCTCTGTCTCTCTCTCTATCTCTCTCAAACCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF641

Protein Analysis

112

Amino Acids

12.26

Weight (kDa)

4.42

Isoelectric Point (pI)

48.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF641 PF04859 12 - 69 2.4e-08 Plant protein of unknown function (DUF641)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 101, 122, 190
AfiI CCNNNNNNNGG 1 cut(s) 118
AgsI TTSAA 3 cut(s) 79, 131, 229
AjnI CCWGG 1 cut(s) 178
AluBI AGCT 6 cut(s) 15, 43, 61, 72, 88, 185
AluI AGCT 6 cut(s) 15, 43, 61, 72, 88, 185
Alw21I GWGCWC 3 cut(s) 63, 90, 187
Alw26I GTCTC 1 cut(s) 312
AoxI GGCC 1 cut(s) 142
ApeKI GCWGC 1 cut(s) 69
AspS9I GGNCC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 179
BanII GRGCYC 3 cut(s) 63, 90, 187
BbsI GAAGAC 1 cut(s) 158
Bbv12I GWGCWC 3 cut(s) 63, 90, 187
BbvI GCAGC 1 cut(s) 81
BccI CCATC 1 cut(s) 245
BciT130I CCWGG 1 cut(s) 180
BcoDI GTCTC 1 cut(s) 312
BisI GCNGC 2 cut(s) 70, 101
BlsI GCNGC 2 cut(s) 71, 102
Bme1390I CCNGG 1 cut(s) 180
BmgT120I GGNCC 1 cut(s) 142
BmiI GGNNCC 1 cut(s) 177
BmrFI CCNGG 1 cut(s) 180
BpiI GAAGAC 1 cut(s) 158
BpmI CTGGAG 1 cut(s) 201
BsaBI GATNNNNATC 1 cut(s) 167
Bsc4I CCNNNNNNNGG 1 cut(s) 118
Bse8I GATNNNNATC 1 cut(s) 167
BseBI CCWGG 1 cut(s) 180
BseGI GGATG 3 cut(s) 256, 268, 280
BseJI GATNNNNATC 1 cut(s) 167
BseLI CCNNNNNNNGG 1 cut(s) 118
BseXI GCAGC 1 cut(s) 81
BshFI GGCC 1 cut(s) 144
BsiHKAI GWGCWC 3 cut(s) 63, 90, 187
BslI CCNNNNNNNGG 1 cut(s) 118
BsmAI GTCTC 1 cut(s) 312
BsnI GGCC 1 cut(s) 144
Bsp1286I GDGCHC 3 cut(s) 63, 90, 187
Bsp143I GATC 3 cut(s) 91, 162, 168
BspACI CCGC 3 cut(s) 101, 122, 190
BspANI GGCC 1 cut(s) 144
BspLI GGNNCC 1 cut(s) 177
BssMI GATC 3 cut(s) 91, 162, 168
Bst2UI CCWGG 1 cut(s) 180
Bst6I CTCTTC 1 cut(s) 240
BstC8I GCNNGC 2 cut(s) 13, 120
BstF5I GGATG 3 cut(s) 256, 268, 280
BstKTI GATC 3 cut(s) 94, 165, 171
BstMAI GTCTC 1 cut(s) 312
BstMBI GATC 3 cut(s) 91, 162, 168
BstNI CCWGG 1 cut(s) 180
BstSCI CCNGG 1 cut(s) 178
BstV1I GCAGC 1 cut(s) 81
BstV2I GAAGAC 1 cut(s) 158
BsuRI GGCC 1 cut(s) 144
BtsCI GGATG 3 cut(s) 256, 268, 280
Cac8I GCNNGC 2 cut(s) 13, 120
Cfr13I GGNCC 1 cut(s) 142
DpnI GATC 3 cut(s) 93, 164, 170
DpnII GATC 3 cut(s) 91, 162, 168
Eam1104I CTCTTC 1 cut(s) 240
EarI CTCTTC 1 cut(s) 240
EciI GGCGGA 1 cut(s) 137
Ecl136II GAGCTC 3 cut(s) 61, 88, 185
Eco24I GRGCYC 3 cut(s) 63, 90, 187
Eco53kI GAGCTC 3 cut(s) 61, 88, 185
EcoICRI GAGCTC 3 cut(s) 61, 88, 185
EcoO109I RGGNCCY 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 178
EcoT38I GRGCYC 3 cut(s) 63, 90, 187
FaiI YATR 3 cut(s) 157, 298, 334
Fnu4HI GCNGC 2 cut(s) 70, 101
FokI GGATG 3 cut(s) 263, 275, 287
FriOI GRGCYC 3 cut(s) 63, 90, 187
Fsp4HI GCNGC 2 cut(s) 70, 101
GluI GCNGC 2 cut(s) 70, 101
GsuI CTGGAG 1 cut(s) 201
HaeIII GGCC 1 cut(s) 144
HinfI GANTC 2 cut(s) 127, 206
HphI GGTGA 1 cut(s) 179
Hpy166II GTNNAC 1 cut(s) 37
Hpy188III TCNNGA 3 cut(s) 76, 131, 166
Hpy8I GTNNAC 1 cut(s) 37
HpyCH4IV ACGT 1 cut(s) 33
HpyCH4V TGCA 3 cut(s) 11, 69, 296
HpySE526I ACGT 1 cut(s) 33
Kzo9I GATC 3 cut(s) 91, 162, 168
LmnI GCTCC 2 cut(s) 175, 182
LpnPI CCDG 5 cut(s) 104, 125, 165, 192, 269
Lsp1109I GCAGC 1 cut(s) 81
MaeII ACGT 1 cut(s) 33
MalI GATC 3 cut(s) 93, 164, 170
MboI GATC 3 cut(s) 91, 162, 168
MboII GAAGA 3 cut(s) 91, 163, 257
MfeI CAATTG 1 cut(s) 104
MhlI GDGCHC 3 cut(s) 63, 90, 187
MluCI AATT 2 cut(s) 104, 291
MlyI GAGTC 1 cut(s) 215
MnlI CCTC 3 cut(s) 235, 241, 281
MspR9I CCNGG 1 cut(s) 180
MunI CAATTG 1 cut(s) 104
MvaI CCWGG 1 cut(s) 180
NdeII GATC 3 cut(s) 91, 162, 168
NlaIV GGNNCC 1 cut(s) 177
PfeI GAWTC 1 cut(s) 127
PkrI GCNGC 2 cut(s) 71, 102
PleI GAGTC 1 cut(s) 214
PpsI GAGTC 1 cut(s) 214
Psp124BI GAGCTC 3 cut(s) 63, 90, 187
Psp6I CCWGG 1 cut(s) 178
PspGI CCWGG 1 cut(s) 178
PspN4I GGNNCC 1 cut(s) 177
PspPI GGNCC 1 cut(s) 142
SacI GAGCTC 3 cut(s) 63, 90, 187
SatI GCNGC 2 cut(s) 70, 101
Sau3AI GATC 3 cut(s) 91, 162, 168
Sau96I GGNCC 1 cut(s) 142
SchI GAGTC 1 cut(s) 215
ScrFI CCNGG 1 cut(s) 180
SduI GDGCHC 3 cut(s) 63, 90, 187
SetI ASST 7 cut(s) 17, 36, 45, 63, 74, 90, 187
SmlI CTYRAG 1 cut(s) 16
SmoI CTYRAG 1 cut(s) 16
Sse9I AATT 2 cut(s) 104, 291
SsiI CCGC 3 cut(s) 101, 122, 190
SstI GAGCTC 3 cut(s) 63, 90, 187
StyD4I CCNGG 1 cut(s) 178
TaiI ACGT 1 cut(s) 36
TaqI TCGA 2 cut(s) 90, 209
TasI AATT 2 cut(s) 104, 291
TauI GCSGC 1 cut(s) 103
TfiI GAWTC 1 cut(s) 127
TseI GCWGC 1 cut(s) 69
TspDTI ATGAA 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.