Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr5

Orthogroup ID

OG0012636

Physical Location & Seq

Genomic Coordinates Forward (+)

34926147 .. 34926731

Gene Structure 585 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000024343

Sequence Viewer

CDS Protein Promoter (2k)

Length: 585 bp

ATGGCCTCGTCGACAGACAAAATGCCTGCAGTTGGTGAGATTCTATTCTCTCCTTCATCTCCATCTCCTTATCCAGAGCCTTCCGAAAGTAGCGGATATTCTTTGCTCTCTTCGGATTCATCAGAACATTCTCCTCCACCATCACCGTCTTACATTGATGCCTTAGCCGCTATTGAAGCAGAGCAGCTTAATCTCTCTCCAGACTACTCTCCTTCACCAGCTCCTTACTTCACCAAATACCCTTCTTCTCCCCCTTACATTGAAGTTGAGGATCCTGAAATCTATGAGCAAGCTCCAGCAACTGAACCGTCTTCTGTTTTTGGGTCGGATCAGTCAGCATCTCCAGACATGGCTCCTCATCCTACTGTATTGCCATTTGACTACAGAGCAGAGGACGAGAGTGCTGAATTTGAAGGTGAAGATTATAGTTCGGAACGAAGCAAGAATCGGATGACGATGGTGGGTTTTGTGATTGGTGCTATTTGCTTGGTGGCATTGGCTGGTTTTTTGTTTAATAAGAAGAAGAAAGACAATAAGCCAAGATCAGAGGACCAGTACGAATTGACCAGGAGGGAGGACGTCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

195

Amino Acids

21.22

Weight (kDa)

4.27

Isoelectric Point (pI)

98.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012636)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g15790 FvH4_6g15810
prunus_persica	Prupe.6G237100_v2.0.a1
pyrus_communis	pycom04g09370 pycom12g11790
rosa_laevigata	RLG00000024343 RLG00000024344
rosa_multiflora	Rmu_sc0004871.1_g000009
rosa_roxburghii	Rroxscaffold_6G00411800
rosa_rugosa	Rorug03G0102300
rosa_samantha	Rh3AG151600 Rh3AG151700 Rh3BG175100 Rh3BG175200 Rh3CG166300 Rh3CG166500 Rh3DG200300 Rh3DG200400
rosa_wichuraiana	Rw3G014290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	582
AccI	GTMKAC	1 cut(s)	11
AciI	CCGC	2 cut(s)	93, 168
AclWI	GGATC	3 cut(s)	266, 279, 336
AcsI	RAATTY	1 cut(s)	407
AcyI	GRCGYC	1 cut(s)	579
AfaI	GTAC	1 cut(s)	557
AfiI	CCNNNNNNNGG	1 cut(s)	32
AgsI	TTSAA	3 cut(s)	176, 263, 413
AjnI	CCWGG	1 cut(s)	566
AluBI	AGCT	3 cut(s)	187, 221, 293
AluI	AGCT	3 cut(s)	187, 221, 293
AlwI	GGATC	3 cut(s)	266, 279, 336
AlwNI	CAGNNNCTG	1 cut(s)	302
AoxI	GGCC	1 cut(s)	3
ApeKI	GCWGC	1 cut(s)	184
ApoI	RAATTY	1 cut(s)	407
AspS9I	GGNCC	1 cut(s)	550
AsuHPI	GGTGA	5 cut(s)	47, 135, 207, 223, 428
AvaII	GGWCC	1 cut(s)	550
BamHI	GGATCC	1 cut(s)	271
BbsI	GAAGAC	1 cut(s)	303
BbvI	GCAGC	1 cut(s)	196
BccI	CCATC	3 cut(s)	70, 148, 451
BciT130I	CCWGG	1 cut(s)	568
BfmI	CTRYAG	2 cut(s)	27, 382
BisI	GCNGC	2 cut(s)	168, 185
BlsI	GCNGC	2 cut(s)	169, 186
Bme1390I	CCNGG	1 cut(s)	568
Bme18I	GGWCC	1 cut(s)	550
BmgT120I	GGNCC	1 cut(s)	550
BmiI	GGNNCC	2 cut(s)	273, 354
BmrFI	CCNGG	1 cut(s)	568
BmsI	GCATC	2 cut(s)	148, 347
BpiI	GAAGAC	1 cut(s)	303
BpmI	CTGGAG	3 cut(s)	183, 279, 327
Bpu10I	CCTNAGC	1 cut(s)	163
BsaHI	GRCGYC	1 cut(s)	579
Bsc4I	CCNNNNNNNGG	1 cut(s)	32
Bse1I	ACTGG	1 cut(s)	553
BseBI	CCWGG	1 cut(s)	568
BseGI	GGATG	2 cut(s)	358, 456
BseLI	CCNNNNNNNGG	1 cut(s)	32
BseNI	ACTGG	1 cut(s)	553
BseRI	GAGGAG	2 cut(s)	123, 345
BseXI	GCAGC	1 cut(s)	196
BshFI	GGCC	1 cut(s)	5
BslI	CCNNNNNNNGG	1 cut(s)	32
BsnI	GGCC	1 cut(s)	5
Bsp143I	GATC	3 cut(s)	271, 328, 542
BspACI	CCGC	2 cut(s)	93, 168
BspANI	GGCC	1 cut(s)	5
BspLI	GGNNCC	2 cut(s)	273, 354
BspMAI	CTGCAG	1 cut(s)	31
BspPI	GGATC	3 cut(s)	266, 279, 336
BsrI	ACTGG	1 cut(s)	553
BssMI	GATC	3 cut(s)	271, 328, 542
BssNI	GRCGYC	1 cut(s)	579
Bst2UI	CCWGG	1 cut(s)	568
Bst4CI	ACNGT	3 cut(s)	147, 309, 367
Bst6I	CTCTTC	1 cut(s)	115
BstACI	GRCGYC	1 cut(s)	579
BstC8I	GCNNGC	2 cut(s)	27, 291
BstDEI	CTNAG	1 cut(s)	163
BstF5I	GGATG	2 cut(s)	358, 456
BstKTI	GATC	3 cut(s)	274, 331, 545
BstMBI	GATC	3 cut(s)	271, 328, 542
BstMWI	GCNNNNNNNGC	2 cut(s)	167, 176
BstNI	CCWGG	1 cut(s)	568
BstSCI	CCNGG	1 cut(s)	566
BstSFI	CTRYAG	2 cut(s)	27, 382
BstV1I	GCAGC	1 cut(s)	196
BstV2I	GAAGAC	1 cut(s)	303
BstX2I	RGATCY	1 cut(s)	271
BstYI	RGATCY	1 cut(s)	271
BsuRI	GGCC	1 cut(s)	5
BtsCI	GGATG	2 cut(s)	358, 456
Cac8I	GCNNGC	2 cut(s)	27, 291
CaiI	CAGNNNCTG	1 cut(s)	302
Cfr13I	GGNCC	1 cut(s)	550
Csp6I	GTAC	1 cut(s)	556
CviAII	CATG	1 cut(s)	349
CviJI	RGCY	9 cut(s)	5, 79, 167, 187, 221, 293, 353, 500, 538
CviKI_1	RGCY	9 cut(s)	5, 79, 167, 187, 221, 293, 353, 500, 538
CviQI	GTAC	1 cut(s)	556
DdeI	CTNAG	1 cut(s)	163
DpnI	GATC	3 cut(s)	273, 330, 544
DpnII	GATC	3 cut(s)	271, 328, 542
Eam1104I	CTCTTC	1 cut(s)	115
EarI	CTCTTC	1 cut(s)	115
Eco47I	GGWCC	1 cut(s)	550
EcoRII	CCWGG	1 cut(s)	566
FaeI	CATG	1 cut(s)	352
FaiI	YATR	3 cut(s)	285, 350, 426
FatI	CATG	1 cut(s)	348
FblI	GTMKAC	1 cut(s)	11
Fnu4HI	GCNGC	2 cut(s)	168, 185
FokI	GGATG	2 cut(s)	345, 463
Fsp4HI	GCNGC	2 cut(s)	168, 185
GluI	GCNGC	2 cut(s)	168, 185
GsuI	CTGGAG	3 cut(s)	183, 279, 327
HaeIII	GGCC	1 cut(s)	5
Hin1I	GRCGYC	1 cut(s)	579
Hin1II	CATG	1 cut(s)	352
HincII	GTYRAC	1 cut(s)	12
HindII	GTYRAC	1 cut(s)	12
HinfI	GANTC	3 cut(s)	40, 116, 445
HphI	GGTGA	5 cut(s)	47, 135, 207, 223, 428
Hpy166II	GTNNAC	1 cut(s)	12
Hpy188I	TCNGA	8 cut(s)	85, 115, 124, 328, 433, 450, 547, 584
Hpy188III	TCNNGA	4 cut(s)	74, 200, 275, 344
Hpy8I	GTNNAC	1 cut(s)	12
Hpy99I	CGWCG	1 cut(s)	13
HpyAV	CCTTC	5 cut(s)	63, 90, 222, 252, 407
HpyCH4III	ACNGT	3 cut(s)	147, 309, 367
HpyCH4IV	ACGT	1 cut(s)	579
HpyCH4V	TGCA	1 cut(s)	29
HpyF10VI	GCNNNNNNNGC	2 cut(s)	167, 176
HpyF3I	CTNAG	1 cut(s)	163
HpySE526I	ACGT	1 cut(s)	579
Hsp92I	GRCGYC	1 cut(s)	579
Hsp92II	CATG	1 cut(s)	352
Kzo9I	GATC	3 cut(s)	271, 328, 542
LmnI	GCTCC	3 cut(s)	226, 298, 358
Lsp1109I	GCAGC	1 cut(s)	196
LweI	GCATC	2 cut(s)	148, 347
MaeII	ACGT	1 cut(s)	579
MalI	GATC	3 cut(s)	273, 330, 544
MboI	GATC	3 cut(s)	271, 328, 542
MboII	GAAGA	6 cut(s)	102, 237, 303, 431, 532, 535
MflI	RGATCY	1 cut(s)	271
MluCI	AATT	2 cut(s)	407, 560
MmeI	TCCRAC	1 cut(s)	306
MnlI	CCTC	8 cut(s)	16, 144, 262, 366, 385, 541, 564, 568
MseI	TTAA	2 cut(s)	189, 513
MspR9I	CCNGG	1 cut(s)	568
MvaI	CCWGG	1 cut(s)	568
MwoI	GCNNNNNNNGC	2 cut(s)	167, 176
NdeII	GATC	3 cut(s)	271, 328, 542
NlaIII	CATG	1 cut(s)	352
NlaIV	GGNNCC	2 cut(s)	273, 354
PfeI	GAWTC	3 cut(s)	40, 116, 445
PkrI	GCNGC	2 cut(s)	169, 186
Psp6I	CCWGG	1 cut(s)	566
PspGI	CCWGG	1 cut(s)	566
PspN4I	GGNNCC	2 cut(s)	273, 354
PspPI	GGNCC	1 cut(s)	550
PstI	CTGCAG	1 cut(s)	31
PstNI	CAGNNNCTG	1 cut(s)	302
PsuI	RGATCY	1 cut(s)	271
RsaI	GTAC	1 cut(s)	557
RsaNI	GTAC	1 cut(s)	556
SalI	GTCGAC	1 cut(s)	10
SaqAI	TTAA	2 cut(s)	189, 513
SatI	GCNGC	2 cut(s)	168, 185
Sau3AI	GATC	3 cut(s)	271, 328, 542
Sau96I	GGNCC	1 cut(s)	550
ScrFI	CCNGG	1 cut(s)	568
SetI	ASST	5 cut(s)	189, 223, 295, 418, 582
SfaNI	GCATC	2 cut(s)	148, 347
SfcI	CTRYAG	2 cut(s)	27, 382
SinI	GGWCC	1 cut(s)	550
Sse9I	AATT	2 cut(s)	407, 560
SsiI	CCGC	2 cut(s)	93, 168
StyD4I	CCNGG	1 cut(s)	566
TaaI	ACNGT	3 cut(s)	147, 309, 367
TaiI	ACGT	1 cut(s)	582
TaqI	TCGA	1 cut(s)	11
TasI	AATT	2 cut(s)	407, 560
TauI	GCSGC	1 cut(s)	170
TfiI	GAWTC	3 cut(s)	40, 116, 445
Tru1I	TTAA	2 cut(s)	189, 513
Tru9I	TTAA	2 cut(s)	189, 513
TseI	GCWGC	1 cut(s)	184
TspDTI	ATGAA	2 cut(s)	45, 108
VpaK11BI	GGWCC	1 cut(s)	550
XapI	RAATTY	1 cut(s)	407
XmiI	GTMKAC	1 cut(s)	11
ZraI	GACGTC	1 cut(s)	580

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.