RLG00000027511

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
12320645 .. 12321494
850 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000027511

Sequence Viewer

Length: 312 bp
ATGTCTACAATAGGTAGTGGTAATTCTCCTTTGGCAAGTCTAGAGTTTGAACTTTTTGAGGACATAAGGTCATCTATGCAGAAACCAGCTAGTCTCAAATTGAAAAGAGGAAGAGGCTTGCAGAATGTCCGTTCCTTGAAGAAAACTGATGCTCAGTGTTGGGTAAGGATTAAATATGTATATTTTGGACTTCAGATGAATGCCTCTGCATCCCAAAGGCAAAATCTTAAGAGAGGTCAGGATCTTAAAAGAGGTTTTGTTTCCACACAAAGACAGGACAATGTTCGGCTCTTTCAAAGGAACCTTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.79

Weight (kDa)

10.98

Isoelectric Point (pI)

46.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 5
AclWI GGATC 1 cut(s) 249
AcuI CTGAAG 1 cut(s) 176
AflII CTTAAG 1 cut(s) 227
AgsI TTSAA 4 cut(s) 50, 103, 139, 296
AhdI GACNNNNNGTC 1 cut(s) 67
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 1 cut(s) 98
AlwI GGATC 1 cut(s) 249
BcoDI GTCTC 1 cut(s) 98
BfaI CTAG 2 cut(s) 41, 90
BfrI CTTAAG 1 cut(s) 227
BmeRI GACNNNNNGTC 1 cut(s) 67
BmiI GGNNCC 1 cut(s) 302
BmsI GCATC 2 cut(s) 139, 218
BseGI GGATG 1 cut(s) 209
BseMII CTCAG 1 cut(s) 167
BsmAI GTCTC 1 cut(s) 98
BsmI GAATGC 1 cut(s) 205
Bsp143I GATC 1 cut(s) 241
BspCNI CTCAG 1 cut(s) 166
BspLI GGNNCC 1 cut(s) 302
BspPI GGATC 1 cut(s) 249
BspTI CTTAAG 1 cut(s) 227
BssMI GATC 1 cut(s) 241
Bst6I CTCTTC 1 cut(s) 106
BstAFI CTTAAG 1 cut(s) 227
BstC8I GCNNGC 1 cut(s) 119
BstDEI CTNAG 1 cut(s) 153
BstF5I GGATG 1 cut(s) 209
BstKTI GATC 1 cut(s) 244
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 1 cut(s) 241
BstX2I RGATCY 1 cut(s) 241
BstYI RGATCY 1 cut(s) 241
BtsCI GGATG 1 cut(s) 209
BtsIMutI CAGTG 1 cut(s) 161
Cac8I GCNNGC 1 cut(s) 119
CviJI RGCY 3 cut(s) 89, 117, 289
CviKI_1 RGCY 3 cut(s) 89, 117, 289
DdeI CTNAG 1 cut(s) 153
DpnI GATC 1 cut(s) 243
DpnII GATC 1 cut(s) 241
DriI GACNNNNNGTC 1 cut(s) 67
Eam1104I CTCTTC 1 cut(s) 106
Eam1105I GACNNNNNGTC 1 cut(s) 67
EarI CTCTTC 1 cut(s) 106
Eco57I CTGAAG 1 cut(s) 176
FaiI YATR 4 cut(s) 65, 77, 177, 181
FblI GTMKAC 1 cut(s) 5
FokI GGATG 1 cut(s) 196
FspBI CTAG 2 cut(s) 41, 90
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 195
Hpy188III TCNNGA 2 cut(s) 41, 239
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4V TGCA 3 cut(s) 79, 121, 209
HpyF3I CTNAG 1 cut(s) 153
Kzo9I GATC 1 cut(s) 241
LpnPI CCDG 3 cut(s) 99, 224, 260
LweI GCATC 2 cut(s) 139, 218
MaeI CTAG 2 cut(s) 41, 90
MalI GATC 1 cut(s) 243
MboI GATC 1 cut(s) 241
MboII GAAGA 2 cut(s) 123, 151
MflI RGATCY 1 cut(s) 241
MluCI AATT 2 cut(s) 22, 98
MnlI CCTC 6 cut(s) 52, 101, 107, 214, 227, 245
MseI TTAA 3 cut(s) 171, 228, 246
MspCI CTTAAG 1 cut(s) 227
Mva1269I GAATGC 1 cut(s) 205
NdeII GATC 1 cut(s) 241
NlaIV GGNNCC 1 cut(s) 302
PctI GAATGC 1 cut(s) 205
PspN4I GGNNCC 1 cut(s) 302
PsuI RGATCY 1 cut(s) 241
SaqAI TTAA 3 cut(s) 171, 228, 246
Sau3AI GATC 1 cut(s) 241
SetI ASST 6 cut(s) 16, 71, 91, 238, 256, 306
SfaNI GCATC 2 cut(s) 139, 218
SgeI CNNG 8 cut(s) 48, 53, 98, 102, 130, 148, 251, 287
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
Sse9I AATT 2 cut(s) 22, 98
SspMI CTAG 2 cut(s) 41, 90
TasI AATT 2 cut(s) 22, 98
Tru1I TTAA 3 cut(s) 171, 228, 246
Tru9I TTAA 3 cut(s) 171, 228, 246
TscAI CASTG 1 cut(s) 161
TspDTI ATGAA 1 cut(s) 212
TspGWI ACGGA 1 cut(s) 119
TspRI CASTG 1 cut(s) 161
Vha464I CTTAAG 1 cut(s) 227
XbaI TCTAGA 1 cut(s) 40
XmiI GTMKAC 1 cut(s) 5
XspI CTAG 2 cut(s) 41, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.