RLG00000031616

Auxin-repressed 12.5 kDa

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
6772995 .. 6773842
848 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000031616

Sequence Viewer

Length: 339 bp
ATGGTTCTGCTAGAGAAGCTTTGGGATGATGTAGTAGCTGGACCTCAGCCTGAACGTGGTCTCGGCAAGCTCAGAAAGGTCACCCCTAAGCCCTTGAACATCAAAGATGAGGGAGAGTCGAGCAAGATCACGATGCCGACGACGCCGACGACGCCGGTGACCCCAACAACGCCGGTTTCGGCACGCAAGGACAACATTTGGAGGAGTGTGTTCCACCCAGGTAGCAACCTTGCGACCAAAACGATGGGAAACCAGGTGTTTGATAGCCCACAGCCAAACTCTCCCACTGTCTATGACTGGATGTACAGTGGGGAGACGAGGAGCAAGCATCATCGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.51

Weight (kDa)

9.57

Isoelectric Point (pI)

53.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_repressed PF05564 7 - 111 2.7e-51 Dormancy/auxin associated protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 2 cut(s) 143, 152
AfaI GTAC 1 cut(s) 305
AfiI CCNNNNNNNGG 1 cut(s) 56
AgsI TTSAA 1 cut(s) 97
AjnI CCWGG 2 cut(s) 217, 252
AluBI AGCT 3 cut(s) 19, 38, 70
AluI AGCT 3 cut(s) 19, 38, 70
Alw26I GTCTC 2 cut(s) 65, 308
AspS9I GGNCC 1 cut(s) 41
AsuHPI GGTGA 2 cut(s) 73, 169
AvaII GGWCC 1 cut(s) 41
BbvCI CCTCAGC 1 cut(s) 45
BccI CCATC 1 cut(s) 238
BciT130I CCWGG 2 cut(s) 219, 254
BcoDI GTCTC 2 cut(s) 65, 308
BfaI CTAG 1 cut(s) 11
Bme1390I CCNGG 2 cut(s) 219, 254
Bme18I GGWCC 1 cut(s) 41
BmgT120I GGNCC 1 cut(s) 41
BmrFI CCNGG 2 cut(s) 219, 254
BmsI GCATC 1 cut(s) 123
Bpu10I CCTNAGC 2 cut(s) 45, 87
BsaHI GRCGYC 2 cut(s) 143, 152
BsaI GGTCTC 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 217
Bsc4I CCNNNNNNNGG 1 cut(s) 56
Bse118I RCCGGY 2 cut(s) 154, 172
Bse1I ACTGG 1 cut(s) 302
BseBI CCWGG 2 cut(s) 219, 254
BseDI CCNNGG 1 cut(s) 217
BseGI GGATG 2 cut(s) 31, 306
BseLI CCNNNNNNNGG 1 cut(s) 56
BseMII CTCAG 2 cut(s) 59, 85
BseNI ACTGG 1 cut(s) 302
BseRI GAGGAG 2 cut(s) 217, 334
BsiSI CCGG 2 cut(s) 155, 173
BslI CCNNNNNNNGG 1 cut(s) 56
BsmAI GTCTC 2 cut(s) 65, 308
BsmBI CGTCTC 1 cut(s) 308
Bso31I GGTCTC 1 cut(s) 65
Bsp1407I TGTACA 1 cut(s) 303
Bsp143I GATC 1 cut(s) 126
BspCNI CTCAG 2 cut(s) 58, 84
BspTNI GGTCTC 1 cut(s) 65
BsrFI RCCGGY 2 cut(s) 154, 172
BsrGI TGTACA 1 cut(s) 303
BsrI ACTGG 1 cut(s) 302
BssAI RCCGGY 2 cut(s) 154, 172
BssECI CCNNGG 1 cut(s) 217
BssMI GATC 1 cut(s) 126
BssNI GRCGYC 2 cut(s) 143, 152
Bst2UI CCWGG 2 cut(s) 219, 254
Bst4CI ACNGT 2 cut(s) 289, 308
BstACI GRCGYC 2 cut(s) 143, 152
BstAUI TGTACA 1 cut(s) 303
BstC8I GCNNGC 3 cut(s) 68, 184, 326
BstDEI CTNAG 3 cut(s) 45, 71, 87
BstEII GGTNACC 2 cut(s) 79, 157
BstF5I GGATG 2 cut(s) 31, 306
BstKTI GATC 1 cut(s) 129
BstMAI GTCTC 2 cut(s) 65, 308
BstMBI GATC 1 cut(s) 126
BstMWI GCNNNNNNNGC 3 cut(s) 16, 142, 151
BstNI CCWGG 2 cut(s) 219, 254
BstPI GGTNACC 2 cut(s) 79, 157
BstSCI CCNGG 2 cut(s) 217, 252
BstXI CCANNNNNNTGG 1 cut(s) 244
BtsCI GGATG 2 cut(s) 31, 306
BtsIMutI CAGTG 2 cut(s) 285, 313
Cac8I GCNNGC 3 cut(s) 68, 184, 326
Cfr10I RCCGGY 2 cut(s) 154, 172
Cfr13I GGNCC 1 cut(s) 41
CseI GACGC 2 cut(s) 151, 160
CsiI ACCWGGT 1 cut(s) 252
Csp6I GTAC 1 cut(s) 304
CviJI RGCY 7 cut(s) 19, 38, 49, 70, 91, 267, 274
CviKI_1 RGCY 7 cut(s) 19, 38, 49, 70, 91, 267, 274
CviQI GTAC 1 cut(s) 304
DdeI CTNAG 3 cut(s) 45, 71, 87
DpnI GATC 1 cut(s) 128
DpnII GATC 1 cut(s) 126
Eco31I GGTCTC 1 cut(s) 65
Eco47I GGWCC 1 cut(s) 41
Eco91I GGTNACC 2 cut(s) 79, 157
EcoO65I GGTNACC 2 cut(s) 79, 157
EcoRII CCWGG 2 cut(s) 217, 252
Esp3I CGTCTC 1 cut(s) 308
FaiI YATR 1 cut(s) 294
FokI GGATG 2 cut(s) 38, 313
FspBI CTAG 1 cut(s) 11
HapII CCGG 2 cut(s) 155, 173
HgaI GACGC 2 cut(s) 151, 160
Hin1I GRCGYC 2 cut(s) 143, 152
HindIII AAGCTT 1 cut(s) 17
HinfI GANTC 1 cut(s) 116
HpaII CCGG 2 cut(s) 155, 173
HphI GGTGA 2 cut(s) 73, 169
Hpy188I TCNGA 1 cut(s) 74
Hpy188III TCNNGA 1 cut(s) 130
Hpy99I CGWCG 4 cut(s) 142, 145, 151, 154
HpyCH4III ACNGT 2 cut(s) 289, 308
HpyCH4IV ACGT 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 3 cut(s) 16, 142, 151
HpyF3I CTNAG 3 cut(s) 45, 71, 87
HpySE526I ACGT 1 cut(s) 55
Hsp92I GRCGYC 2 cut(s) 143, 152
Kzo9I GATC 1 cut(s) 126
LmnI GCTCC 1 cut(s) 321
LpnPI CCDG 9 cut(s) 24, 63, 168, 186, 204, 231, 239, 266, 283
LweI GCATC 1 cut(s) 123
MabI ACCWGGT 1 cut(s) 252
MaeI CTAG 1 cut(s) 11
MaeII ACGT 1 cut(s) 55
MaeIII GTNAC 2 cut(s) 79, 157
MalI GATC 1 cut(s) 128
MboI GATC 1 cut(s) 126
MlyI GAGTC 1 cut(s) 125
MnlI CCTC 4 cut(s) 54, 103, 195, 312
MseI TTAA 1 cut(s) 337
MspI CCGG 2 cut(s) 155, 173
MspR9I CCNGG 2 cut(s) 219, 254
MvaI CCWGG 2 cut(s) 219, 254
MwoI GCNNNNNNNGC 3 cut(s) 16, 142, 151
NdeII GATC 1 cut(s) 126
NmeAIII GCCGAG 1 cut(s) 42
NmuCI GTSAC 2 cut(s) 79, 157
PcsI WCGNNNNNNNCGW 2 cut(s) 137, 146
PleI GAGTC 1 cut(s) 124
PpsI GAGTC 1 cut(s) 124
Psp6I CCWGG 2 cut(s) 217, 252
PspEI GGTNACC 2 cut(s) 79, 157
PspGI CCWGG 2 cut(s) 217, 252
PspPI GGNCC 1 cut(s) 41
RsaI GTAC 1 cut(s) 305
RsaNI GTAC 1 cut(s) 304
SaqAI TTAA 1 cut(s) 337
Sau3AI GATC 1 cut(s) 126
Sau96I GGNCC 1 cut(s) 41
SchI GAGTC 1 cut(s) 125
ScrFI CCNGG 2 cut(s) 219, 254
SetI ASST 9 cut(s) 21, 40, 46, 58, 72, 81, 223, 231, 258
SexAI ACCWGGT 1 cut(s) 252
SfaNI GCATC 1 cut(s) 123
SgrAI CRCCGGYG 1 cut(s) 154
SinI GGWCC 1 cut(s) 41
SspMI CTAG 1 cut(s) 11
StyD4I CCNGG 2 cut(s) 217, 252
TaaI ACNGT 2 cut(s) 289, 308
TaiI ACGT 1 cut(s) 58
TaqI TCGA 1 cut(s) 119
TatI WGTACW 1 cut(s) 303
Tru1I TTAA 1 cut(s) 337
Tru9I TTAA 1 cut(s) 337
TscAI CASTG 2 cut(s) 292, 313
TseFI GTSAC 2 cut(s) 79, 157
Tsp45I GTSAC 2 cut(s) 79, 157
TspRI CASTG 2 cut(s) 292, 313
VpaK11BI GGWCC 1 cut(s) 41
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.