Rmu_co7965312.1_g000001

XS domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7965312.1
Physical Location & Seq
Reverse (-)
1 .. 417
417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7965312.1_g000001.1.cds

Sequence Viewer

Length: 322 bp
atgcgtactttcaggtctgcaaaagattttccggatatgcatagtctcatcatgcacagttacaacacggacaatgcggacattcgtgtggatcacttgggcttacacaaggctttgtgtgttttaaaggggtggaactactcaaagcctcctgataactcaaaggcatatcagttcctttccgctgatgaagcagcagcaaatcaagatgacttgattatgtggccgcccatggtgataattcataatacgcttacaggaaagagtaaagatggccgcatggagggtttgggcaataaagctatggatagttatatacgag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.14

Weight (kDa)

6.96

Isoelectric Point (pI)

30.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 31
AciI CCGC 4 cut(s) 77, 183, 227, 277
AclWI GGATC 1 cut(s) 99
AcoI YGGCCR 2 cut(s) 224, 274
AfaI GTAC 1 cut(s) 7
AfiI CCNNNNNNNGG 1 cut(s) 283
AluBI AGCT 1 cut(s) 302
AluI AGCT 1 cut(s) 302
Alw26I GTCTC 1 cut(s) 50
AlwI GGATC 1 cut(s) 99
Aor13HI TCCGGA 1 cut(s) 31
AoxI GGCC 2 cut(s) 224, 274
ApeKI GCWGC 2 cut(s) 194, 197
AsuHPI GGTGA 1 cut(s) 247
BbvI GCAGC 2 cut(s) 206, 209
BccI CCATC 1 cut(s) 266
BcoDI GTCTC 1 cut(s) 50
BisI GCNGC 4 cut(s) 195, 198, 227, 277
BlsI GCNGC 4 cut(s) 196, 199, 228, 278
BsaJI CCNNGG 1 cut(s) 231
BsaWI WCCGGW 1 cut(s) 31
Bsc4I CCNNNNNNNGG 1 cut(s) 283
BseAI TCCGGA 1 cut(s) 31
BseDI CCNNGG 1 cut(s) 231
BseLI CCNNNNNNNGG 1 cut(s) 283
BseXI GCAGC 2 cut(s) 206, 209
BshFI GGCC 2 cut(s) 226, 276
BsiSI CCGG 1 cut(s) 32
BslI CCNNNNNNNGG 1 cut(s) 283
BsmAI GTCTC 1 cut(s) 50
BsnI GGCC 2 cut(s) 226, 276
Bsp13I TCCGGA 1 cut(s) 31
Bsp143I GATC 1 cut(s) 91
Bsp19I CCATGG 1 cut(s) 231
BspACI CCGC 4 cut(s) 77, 183, 227, 277
BspANI GGCC 2 cut(s) 226, 276
BspEI TCCGGA 1 cut(s) 31
BspPI GGATC 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 231
BssMI GATC 1 cut(s) 91
BssT1I CCWWGG 1 cut(s) 231
Bst4CI ACNGT 1 cut(s) 59
BstDSI CCRYGG 1 cut(s) 231
BstKTI GATC 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 50
BstMBI GATC 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstV1I GCAGC 2 cut(s) 206, 209
BsuRI GGCC 2 cut(s) 226, 276
BtgI CCRYGG 1 cut(s) 231
Csp6I GTAC 1 cut(s) 6
CviAII CATG 3 cut(s) 52, 232, 280
CviJI RGCY 6 cut(s) 102, 113, 148, 226, 276, 302
CviKI_1 RGCY 6 cut(s) 102, 113, 148, 226, 276, 302
CviQI GTAC 1 cut(s) 6
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
DraI TTTAAA 1 cut(s) 126
EaeI YGGCCR 2 cut(s) 224, 274
Eco130I CCWWGG 1 cut(s) 231
EcoT14I CCWWGG 1 cut(s) 231
EcoT22I ATGCAT 1 cut(s) 42
ErhI CCWWGG 1 cut(s) 231
FaeI CATG 3 cut(s) 55, 235, 283
FatI CATG 3 cut(s) 51, 231, 279
Fnu4HI GCNGC 4 cut(s) 195, 198, 227, 277
Fsp4HI GCNGC 4 cut(s) 195, 198, 227, 277
GluI GCNGC 4 cut(s) 195, 198, 227, 277
HaeIII GGCC 2 cut(s) 226, 276
HapII CCGG 1 cut(s) 32
Hin1II CATG 3 cut(s) 55, 235, 283
HpaII CCGG 1 cut(s) 32
HphI GGTGA 1 cut(s) 247
Hpy188III TCNNGA 3 cut(s) 32, 152, 206
HpyCH4III ACNGT 1 cut(s) 59
HpyCH4V TGCA 3 cut(s) 20, 40, 55
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
Hsp92II CATG 3 cut(s) 55, 235, 283
Kpn2I TCCGGA 1 cut(s) 31
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 3 cut(s) 45, 165, 243
Lsp1109I GCAGC 2 cut(s) 206, 209
MaeIII GTNAC 1 cut(s) 59
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MluCI AATT 1 cut(s) 240
MnlI CCTC 2 cut(s) 159, 277
Mph1103I ATGCAT 1 cut(s) 42
MroI TCCGGA 1 cut(s) 31
MseI TTAA 1 cut(s) 125
MslI CAYNNNNRTG 1 cut(s) 86
MspA1I CMGCKG 1 cut(s) 185
MspI CCGG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 191
NcoI CCATGG 1 cut(s) 231
NdeII GATC 1 cut(s) 91
NlaIII CATG 3 cut(s) 55, 235, 283
NsiI ATGCAT 1 cut(s) 42
PkrI GCNGC 4 cut(s) 196, 199, 228, 278
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
RseI CAYNNNNRTG 1 cut(s) 86
SaqAI TTAA 1 cut(s) 125
SatI GCNGC 4 cut(s) 195, 198, 227, 277
Sau3AI GATC 1 cut(s) 91
SetI ASST 2 cut(s) 17, 304
SmiMI CAYNNNNRTG 1 cut(s) 86
Sse9I AATT 1 cut(s) 240
SsiI CCGC 4 cut(s) 77, 183, 227, 277
StyI CCWWGG 1 cut(s) 231
TaaI ACNGT 1 cut(s) 59
TasI AATT 1 cut(s) 240
TauI GCSGC 2 cut(s) 229, 279
Tru1I TTAA 1 cut(s) 125
Tru9I TTAA 1 cut(s) 125
TseI GCWGC 2 cut(s) 194, 197
TspDTI ATGAA 2 cut(s) 204, 233
TspGWI ACGGA 1 cut(s) 83
Zsp2I ATGCAT 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.