Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co7991258.1

Orthogroup ID

OG0012566

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 520

Gene Structure 520 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co7991258.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 520 bp

tttgatgggttggtcaagagagatgctgtgtcttggagtgtgatgattaatgggtatggcttgaatgggaatggcgaagctgccctagatcttttcttgcagatgaagctatcagggatagcgcctaatggggttacttatttaagtgttttatcagcctgcagccattctggattggttgagcaaggccgcgccgtattccaatctatggcagaacatgggataacacgccaaatgaagcactatgcttgcatggtagaccttctaggaagaacgggtaatttgactgaggcttatgacattgttcgggaactaccctgtaaaccttcaacaagcctacttgagtctctgctgggtgcttgtagaattcatgggaacgttgaacttggacagaaaattggtgggttgctctctgaattggaccctgaaaattcaagaccacatgtaatgcttcataatatttatgccgcagctgggagatggactgatgctggtagagtaaggtctaagattgaagaga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2 WEMBL

Protein Analysis

173

Amino Acids

18.76

Weight (kDa)

6.33

Isoelectric Point (pI)

46.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012566)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g15970
malus_domestica	MD02G1171400.v1.1
prunus_persica	Prupe.7G134000_v2.0.a1
pyrus_communis	pycom02g13810
rosa_chinensis	RchiOBHm_Chr2g0105571 RchiOBHm_Chr4g0419421
rosa_laevigata	RLG00000009251 RLG00000017437 RLG00000025539
rosa_multiflora	Rmu_co7991258.1_g000001 Rmu_sc0001051.1_g000009 Rmu_sc0006395.1_g000003
rosa_roxburghii	Rroxscaffold_2G00138120
rosa_rugosa	Rorug02G0128300
rosa_samantha	Rh2AG179900 Rh2BG189000 Rh2CG184200 Rh2DG185700
rosa_wichuraiana	Rw2G014070

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	208
AccI	GTMKAC	1 cut(s)	258
AccII	CGCG	1 cut(s)	192
AciI	CCGC	2 cut(s)	190, 468
AclI	AACGTT	1 cut(s)	378
AcsI	RAATTY	2 cut(s)	366, 430
AfiI	CCNNNNNNNGG	2 cut(s)	208, 474
AflIII	ACRYGT	1 cut(s)	442
AgsI	TTSAA	5 cut(s)	64, 330, 383, 435, 515
AluBI	AGCT	3 cut(s)	80, 109, 473
AluI	AGCT	3 cut(s)	80, 109, 473
Alw26I	GTCTC	1 cut(s)	351
AoxI	GGCC	1 cut(s)	187
ApeKI	GCWGC	3 cut(s)	80, 162, 470
ApoI	RAATTY	2 cut(s)	366, 430
AseI	ATTAAT	1 cut(s)	48
AspLEI	GCGC	2 cut(s)	124, 194
AspS9I	GGNCC	1 cut(s)	421
AvaII	GGWCC	1 cut(s)	421
BbvI	GCAGC	3 cut(s)	67, 174, 482
BccI	CCATC	1 cut(s)	474
BceAI	ACGGC	1 cut(s)	179
BcoDI	GTCTC	1 cut(s)	351
BfaI	CTAG	2 cut(s)	86, 266
BfmI	CTRYAG	1 cut(s)	160
BfoI	RGCGCY	1 cut(s)	125
BglII	AGATCT	1 cut(s)	88
BisI	GCNGC	5 cut(s)	81, 163, 190, 468, 471
BlsI	GCNGC	5 cut(s)	82, 164, 191, 469, 472
Bme18I	GGWCC	1 cut(s)	421
BmgT120I	GGNCC	1 cut(s)	421
BmiI	GGNNCC	1 cut(s)	423
BmsI	GCATC	2 cut(s)	13, 478
BpuEI	CTTGAG	1 cut(s)	362
Bsc4I	CCNNNNNNNGG	2 cut(s)	208, 474
BseLI	CCNNNNNNNGG	2 cut(s)	208, 474
BseMII	CTCAG	1 cut(s)	279
BseXI	GCAGC	3 cut(s)	67, 174, 482
BseYI	CCCAGC	2 cut(s)	352, 473
Bsh1236I	CGCG	1 cut(s)	192
BshFI	GGCC	1 cut(s)	189
BslI	CCNNNNNNNGG	2 cut(s)	208, 474
BsmAI	GTCTC	1 cut(s)	351
BsnI	GGCC	1 cut(s)	189
Bsp143I	GATC	1 cut(s)	88
BspACI	CCGC	2 cut(s)	190, 468
BspANI	GGCC	1 cut(s)	189
BspCNI	CTCAG	1 cut(s)	280
BspFNI	CGCG	1 cut(s)	192
BspLI	GGNNCC	1 cut(s)	423
BspMAI	CTGCAG	1 cut(s)	164
BssMI	GATC	1 cut(s)	88
Bst6I	CTCTTC	1 cut(s)	510
BstC8I	GCNNGC	2 cut(s)	160, 250
BstDEI	CTNAG	2 cut(s)	288, 507
BstFNI	CGCG	1 cut(s)	192
BstH2I	RGCGCY	1 cut(s)	125
BstHHI	GCGC	2 cut(s)	124, 194
BstKTI	GATC	1 cut(s)	91
BstMAI	GTCTC	1 cut(s)	351
BstMBI	GATC	1 cut(s)	88
BstMWI	GCNNNNNNNGC	1 cut(s)	106
BstNSI	RCATGY	1 cut(s)	446
BstSFI	CTRYAG	1 cut(s)	160
BstUI	CGCG	1 cut(s)	192
BstV1I	GCAGC	3 cut(s)	67, 174, 482
BstX2I	RGATCY	1 cut(s)	88
BstYI	RGATCY	1 cut(s)	88
BsuRI	GGCC	1 cut(s)	189
Cac8I	GCNNGC	2 cut(s)	160, 250
CfoI	GCGC	2 cut(s)	124, 194
Cfr13I	GGNCC	1 cut(s)	421
CviAII	CATG	4 cut(s)	218, 253, 371, 443
CviJI	RGCY	9 cut(s)	60, 80, 109, 158, 165, 189, 293, 336, 473
CviKI_1	RGCY	9 cut(s)	60, 80, 109, 158, 165, 189, 293, 336, 473
DdeI	CTNAG	2 cut(s)	288, 507
DpnI	GATC	1 cut(s)	90
DpnII	GATC	1 cut(s)	88
Eam1104I	CTCTTC	1 cut(s)	510
EarI	CTCTTC	1 cut(s)	510
Eco47I	GGWCC	1 cut(s)	421
EcoRI	GAATTC	1 cut(s)	366
FaeI	CATG	4 cut(s)	221, 256, 374, 446
FatI	CATG	4 cut(s)	217, 252, 370, 442
FblI	GTMKAC	1 cut(s)	258
Fnu4HI	GCNGC	5 cut(s)	81, 163, 190, 468, 471
Fsp4HI	GCNGC	5 cut(s)	81, 163, 190, 468, 471
FspBI	CTAG	2 cut(s)	86, 266
GlaI	GCGC	2 cut(s)	123, 193
GluI	GCNGC	5 cut(s)	81, 163, 190, 468, 471
GsaI	CCCAGC	2 cut(s)	356, 477
HaeII	RGCGCY	1 cut(s)	125
HaeIII	GGCC	1 cut(s)	189
HhaI	GCGC	2 cut(s)	124, 194
Hin1II	CATG	4 cut(s)	221, 256, 374, 446
Hin6I	GCGC	2 cut(s)	122, 192
HinP1I	GCGC	2 cut(s)	122, 192
HinfI	GANTC	1 cut(s)	344
Hpy166II	GTNNAC	2 cut(s)	259, 323
Hpy188I	TCNGA	1 cut(s)	415
Hpy188III	TCNNGA	4 cut(s)	16, 171, 308, 435
Hpy8I	GTNNAC	2 cut(s)	259, 323
HpyAV	CCTTC	2 cut(s)	272, 336
HpyCH4IV	ACGT	1 cut(s)	378
HpyCH4V	TGCA	3 cut(s)	100, 162, 252
HpyF10VI	GCNNNNNNNGC	1 cut(s)	106
HpyF3I	CTNAG	2 cut(s)	288, 507
HpySE526I	ACGT	1 cut(s)	378
Hsp92II	CATG	4 cut(s)	221, 256, 374, 446
HspAI	GCGC	2 cut(s)	122, 192
Kzo9I	GATC	1 cut(s)	88
LpnPI	CCDG	8 cut(s)	99, 156, 172, 331, 338, 438, 459, 477
Lsp1109I	GCAGC	3 cut(s)	67, 174, 482
LweI	GCATC	2 cut(s)	13, 478
MaeI	CTAG	2 cut(s)	86, 266
MaeII	ACGT	1 cut(s)	378
MaeIII	GTNAC	1 cut(s)	133
MalI	GATC	1 cut(s)	90
MboI	GATC	1 cut(s)	88
MboII	GAAGA	1 cut(s)	282
MflI	RGATCY	1 cut(s)	88
MluCI	AATT	5 cut(s)	280, 366, 396, 416, 430
MlyI	GAGTC	1 cut(s)	353
MnlI	CCTC	1 cut(s)	283
MseI	TTAA	2 cut(s)	48, 143
MspA1I	CMGCKG	1 cut(s)	473
MvnI	CGCG	1 cut(s)	192
MwoI	GCNNNNNNNGC	1 cut(s)	106
NdeII	GATC	1 cut(s)	88
NlaIII	CATG	4 cut(s)	221, 256, 374, 446
NlaIV	GGNNCC	1 cut(s)	423
NspI	RCATGY	1 cut(s)	446
PciI	ACATGT	1 cut(s)	442
PflMI	CCANNNNNTGG	1 cut(s)	208
PkrI	GCNGC	5 cut(s)	82, 164, 191, 469, 472
PleI	GAGTC	1 cut(s)	352
PpsI	GAGTC	1 cut(s)	352
PscI	ACATGT	1 cut(s)	442
PshBI	ATTAAT	1 cut(s)	48
Psp1406I	AACGTT	1 cut(s)	378
PspFI	CCCAGC	2 cut(s)	352, 473
PspN4I	GGNNCC	1 cut(s)	423
PspPI	GGNCC	1 cut(s)	421
PstI	CTGCAG	1 cut(s)	164
PsuI	RGATCY	1 cut(s)	88
PvuII	CAGCTG	1 cut(s)	473
SaqAI	TTAA	2 cut(s)	48, 143
SatI	GCNGC	5 cut(s)	81, 163, 190, 468, 471
Sau3AI	GATC	1 cut(s)	88
Sau96I	GGNCC	1 cut(s)	421
SchI	GAGTC	1 cut(s)	353
SetI	ASST	7 cut(s)	82, 111, 264, 328, 381, 475, 506
SfaNI	GCATC	2 cut(s)	13, 478
SfcI	CTRYAG	1 cut(s)	160
SinI	GGWCC	1 cut(s)	421
SmlI	CTYRAG	1 cut(s)	341
SmoI	CTYRAG	1 cut(s)	341
Sse9I	AATT	5 cut(s)	280, 366, 396, 416, 430
SsiI	CCGC	2 cut(s)	190, 468
SspI	AATATT	1 cut(s)	460
SspMI	CTAG	2 cut(s)	86, 266
TaiI	ACGT	1 cut(s)	381
TasI	AATT	5 cut(s)	280, 366, 396, 416, 430
TauI	GCSGC	2 cut(s)	192, 470
Tru1I	TTAA	2 cut(s)	48, 143
Tru9I	TTAA	2 cut(s)	48, 143
TseI	GCWGC	3 cut(s)	80, 162, 470
TspDTI	ATGAA	4 cut(s)	119, 251, 359, 443
Van91I	CCANNNNNTGG	1 cut(s)	208
VpaK11BI	GGWCC	1 cut(s)	421
VspI	ATTAAT	1 cut(s)	48
XapI	RAATTY	2 cut(s)	366, 430
XceI	RCATGY	1 cut(s)	446
XmiI	GTMKAC	1 cut(s)	258
XspI	CTAG	2 cut(s)	86, 266

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.