Rmu_sc0006395.1_g000003

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006395.1
OG0012566
Physical Location & Seq
Forward (+)
16093 .. 16764
672 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006395.1_g000003.1.cds

Sequence Viewer

Length: 672 bp
atgggttacatcattcgcaagggctttgacaaagatctggttattagtaatgcactaatagatttgcattcaagatgtggaaacatatgcattgcgagaaagctctttgatgggttggtcaagagagatgctgtgtcttggagtgtgatgattaatgggtatggcttgaatgggaatggcgaagctgccctagatcttttcttgcagatgaagctatcagggatagcgcctaatggggttacttatttaagtgttttatcagcctgcagccattctggattggttgagcaaggccgcgccgtattccaatctatggcagaacatgggataacacgccaaatgaagcactatgcttgcatggtagaccttctaggaagaacgggtaatttgactgaggcttatgacattgttcgggaactaccctgtaaaccttcaacaagcctacttgagtctctgctgggtgcttgtagaattcatgggaacgttgaacttggacagaaaattggtgggttgctctctgaattggaccctgaaaattcaagaccacatgtaatgcttcataatatttatgccgcagctgggagatggactgatgctggtagagtaaggtctaagattgaagagagaagtttgagaaaagttcctggtttcagtcttctaatgggacattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 WEMBL

Protein Analysis

223

Amino Acids

24.36

Weight (kDa)

8.75

Isoelectric Point (pI)

43.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 313
AccI GTMKAC 1 cut(s) 363
AccII CGCG 1 cut(s) 297
AciI CCGC 2 cut(s) 295, 573
AclI AACGTT 1 cut(s) 483
AcsI RAATTY 2 cut(s) 471, 535
AfiI CCNNNNNNNGG 2 cut(s) 313, 579
AflIII ACRYGT 1 cut(s) 547
AgsI TTSAA 6 cut(s) 72, 169, 435, 488, 540, 620
AjnI CCWGG 1 cut(s) 643
AluBI AGCT 4 cut(s) 103, 185, 214, 578
AluI AGCT 4 cut(s) 103, 185, 214, 578
Alw26I GTCTC 1 cut(s) 456
AoxI GGCC 1 cut(s) 292
ApeKI GCWGC 3 cut(s) 185, 267, 575
ApoI RAATTY 2 cut(s) 471, 535
AseI ATTAAT 1 cut(s) 153
AspLEI GCGC 2 cut(s) 229, 299
AspS9I GGNCC 1 cut(s) 526
AvaII GGWCC 1 cut(s) 526
BbsI GAAGAC 1 cut(s) 647
BbvI GCAGC 3 cut(s) 172, 279, 587
BccI CCATC 2 cut(s) 104, 579
BceAI ACGGC 1 cut(s) 284
BciT130I CCWGG 1 cut(s) 645
BcoDI GTCTC 1 cut(s) 456
BfaI CTAG 2 cut(s) 191, 371
BfmI CTRYAG 1 cut(s) 265
BfoI RGCGCY 1 cut(s) 230
BglII AGATCT 2 cut(s) 34, 193
BisI GCNGC 5 cut(s) 186, 268, 295, 573, 576
BlsI GCNGC 5 cut(s) 187, 269, 296, 574, 577
Bme1390I CCNGG 1 cut(s) 645
Bme18I GGWCC 1 cut(s) 526
BmgT120I GGNCC 1 cut(s) 526
BmiI GGNNCC 1 cut(s) 528
BmrFI CCNGG 1 cut(s) 645
BmsI GCATC 2 cut(s) 118, 583
BpiI GAAGAC 1 cut(s) 647
BpuEI CTTGAG 1 cut(s) 467
Bsc4I CCNNNNNNNGG 2 cut(s) 313, 579
Bse3DI GCAATG 1 cut(s) 90
BseBI CCWGG 1 cut(s) 645
BseLI CCNNNNNNNGG 2 cut(s) 313, 579
BseMI GCAATG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 384
BseXI GCAGC 3 cut(s) 172, 279, 587
BseYI CCCAGC 2 cut(s) 457, 578
Bsh1236I CGCG 1 cut(s) 297
BshFI GGCC 1 cut(s) 294
BslI CCNNNNNNNGG 2 cut(s) 313, 579
BsmAI GTCTC 1 cut(s) 456
BsmI GAATGC 1 cut(s) 67
BsnI GGCC 1 cut(s) 294
Bsp143I GATC 2 cut(s) 34, 193
BspACI CCGC 2 cut(s) 295, 573
BspANI GGCC 1 cut(s) 294
BspCNI CTCAG 1 cut(s) 385
BspFNI CGCG 1 cut(s) 297
BspLI GGNNCC 1 cut(s) 528
BspMAI CTGCAG 1 cut(s) 269
BsrDI GCAATG 1 cut(s) 90
BssMI GATC 2 cut(s) 34, 193
Bst2UI CCWGG 1 cut(s) 645
Bst6I CTCTTC 1 cut(s) 615
BstC8I GCNNGC 2 cut(s) 265, 355
BstDEI CTNAG 2 cut(s) 393, 612
BstFNI CGCG 1 cut(s) 297
BstH2I RGCGCY 1 cut(s) 230
BstHHI GCGC 2 cut(s) 229, 299
BstKTI GATC 2 cut(s) 37, 196
BstMAI GTCTC 1 cut(s) 456
BstMBI GATC 2 cut(s) 34, 193
BstMWI GCNNNNNNNGC 1 cut(s) 211
BstNI CCWGG 1 cut(s) 645
BstNSI RCATGY 1 cut(s) 551
BstSCI CCNGG 1 cut(s) 643
BstSFI CTRYAG 1 cut(s) 265
BstUI CGCG 1 cut(s) 297
BstV1I GCAGC 3 cut(s) 172, 279, 587
BstV2I GAAGAC 1 cut(s) 647
BstX2I RGATCY 2 cut(s) 34, 193
BstYI RGATCY 2 cut(s) 34, 193
BsuRI GGCC 1 cut(s) 294
Cac8I GCNNGC 2 cut(s) 265, 355
CfoI GCGC 2 cut(s) 229, 299
Cfr13I GGNCC 1 cut(s) 526
CviAII CATG 4 cut(s) 323, 358, 476, 548
DdeI CTNAG 2 cut(s) 393, 612
DpnI GATC 2 cut(s) 36, 195
DpnII GATC 2 cut(s) 34, 193
Eam1104I CTCTTC 1 cut(s) 615
EarI CTCTTC 1 cut(s) 615
Eco47I GGWCC 1 cut(s) 526
EcoRI GAATTC 1 cut(s) 471
EcoRII CCWGG 1 cut(s) 643
EcoT22I ATGCAT 1 cut(s) 92
FaeI CATG 4 cut(s) 326, 361, 479, 551
FatI CATG 4 cut(s) 322, 357, 475, 547
FauNDI CATATG 1 cut(s) 86
FblI GTMKAC 1 cut(s) 363
Fnu4HI GCNGC 5 cut(s) 186, 268, 295, 573, 576
Fsp4HI GCNGC 5 cut(s) 186, 268, 295, 573, 576
FspBI CTAG 2 cut(s) 191, 371
GlaI GCGC 2 cut(s) 228, 298
GluI GCNGC 5 cut(s) 186, 268, 295, 573, 576
GsaI CCCAGC 2 cut(s) 461, 582
HaeII RGCGCY 1 cut(s) 230
HaeIII GGCC 1 cut(s) 294
HhaI GCGC 2 cut(s) 229, 299
Hin1II CATG 4 cut(s) 326, 361, 479, 551
Hin6I GCGC 2 cut(s) 227, 297
HinP1I GCGC 2 cut(s) 227, 297
HinfI GANTC 1 cut(s) 449
Hpy166II GTNNAC 2 cut(s) 364, 428
Hpy188I TCNGA 1 cut(s) 520
Hpy188III TCNNGA 5 cut(s) 72, 121, 276, 413, 540
Hpy8I GTNNAC 2 cut(s) 364, 428
HpyAV CCTTC 2 cut(s) 377, 441
HpyCH4IV ACGT 1 cut(s) 483
HpyCH4V TGCA 6 cut(s) 53, 67, 90, 205, 267, 357
HpyF10VI GCNNNNNNNGC 1 cut(s) 211
HpyF3I CTNAG 2 cut(s) 393, 612
HpySE526I ACGT 1 cut(s) 483
Hsp92II CATG 4 cut(s) 326, 361, 479, 551
HspAI GCGC 2 cut(s) 227, 297
Kzo9I GATC 2 cut(s) 34, 193
Lsp1109I GCAGC 3 cut(s) 172, 279, 587
LweI GCATC 2 cut(s) 118, 583
MaeI CTAG 2 cut(s) 191, 371
MaeII ACGT 1 cut(s) 483
MaeIII GTNAC 2 cut(s) 5, 238
MalI GATC 2 cut(s) 36, 195
MboI GATC 2 cut(s) 34, 193
MboII GAAGA 3 cut(s) 387, 632, 647
MflI RGATCY 2 cut(s) 34, 193
MluCI AATT 5 cut(s) 385, 471, 501, 521, 535
MlyI GAGTC 1 cut(s) 458
MnlI CCTC 1 cut(s) 388
Mph1103I ATGCAT 1 cut(s) 92
MseI TTAA 3 cut(s) 153, 248, 670
MspA1I CMGCKG 1 cut(s) 578
MspR9I CCNGG 1 cut(s) 645
Mva1269I GAATGC 1 cut(s) 67
MvaI CCWGG 1 cut(s) 645
MvnI CGCG 1 cut(s) 297
MwoI GCNNNNNNNGC 1 cut(s) 211
NdeI CATATG 1 cut(s) 86
NdeII GATC 2 cut(s) 34, 193
NlaIII CATG 4 cut(s) 326, 361, 479, 551
NlaIV GGNNCC 1 cut(s) 528
NsiI ATGCAT 1 cut(s) 92
NspI RCATGY 1 cut(s) 551
PciI ACATGT 1 cut(s) 547
PctI GAATGC 1 cut(s) 67
PflMI CCANNNNNTGG 1 cut(s) 313
PkrI GCNGC 5 cut(s) 187, 269, 296, 574, 577
PleI GAGTC 1 cut(s) 457
PpsI GAGTC 1 cut(s) 457
PscI ACATGT 1 cut(s) 547
PshBI ATTAAT 1 cut(s) 153
Psp1406I AACGTT 1 cut(s) 483
Psp6I CCWGG 1 cut(s) 643
PspFI CCCAGC 2 cut(s) 457, 578
PspGI CCWGG 1 cut(s) 643
PspN4I GGNNCC 1 cut(s) 528
PspPI GGNCC 1 cut(s) 526
PstI CTGCAG 1 cut(s) 269
PsuI RGATCY 2 cut(s) 34, 193
PvuII CAGCTG 1 cut(s) 578
SaqAI TTAA 3 cut(s) 153, 248, 670
SatI GCNGC 5 cut(s) 186, 268, 295, 573, 576
Sau3AI GATC 2 cut(s) 34, 193
Sau96I GGNCC 1 cut(s) 526
SchI GAGTC 1 cut(s) 458
ScrFI CCNGG 1 cut(s) 645
SetI ASST 8 cut(s) 105, 187, 216, 369, 433, 486, 580, 611
SfaNI GCATC 2 cut(s) 118, 583
SfcI CTRYAG 1 cut(s) 265
SinI GGWCC 1 cut(s) 526
SmlI CTYRAG 1 cut(s) 446
SmoI CTYRAG 1 cut(s) 446
Sse9I AATT 5 cut(s) 385, 471, 501, 521, 535
SsiI CCGC 2 cut(s) 295, 573
SspI AATATT 1 cut(s) 565
SspMI CTAG 2 cut(s) 191, 371
StyD4I CCNGG 1 cut(s) 643
TaiI ACGT 1 cut(s) 486
TasI AATT 5 cut(s) 385, 471, 501, 521, 535
TauI GCSGC 2 cut(s) 297, 575
Tru1I TTAA 3 cut(s) 153, 248, 670
Tru9I TTAA 3 cut(s) 153, 248, 670
TseI GCWGC 3 cut(s) 185, 267, 575
TspDTI ATGAA 4 cut(s) 224, 356, 464, 548
Van91I CCANNNNNTGG 1 cut(s) 313
VpaK11BI GGWCC 1 cut(s) 526
VspI ATTAAT 1 cut(s) 153
XapI RAATTY 2 cut(s) 471, 535
XceI RCATGY 1 cut(s) 551
XmiI GTMKAC 1 cut(s) 363
XspI CTAG 2 cut(s) 191, 371
Zsp2I ATGCAT 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.