Rmu_co7991772.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7991772.1
Physical Location & Seq
Forward (+)
1 .. 521
521 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7991772.1_g000001.1.cds

Sequence Viewer

Length: 455 bp
aacatcagcttattagaggaagtgttttctgtgaactctaatgcagaagagtccatcggggatggatcatccatatcaaaccatgacatgactactacagaaggtgacaatggggatatggtctcagggttgaagttaaagttgagatcaaatccaatgagaaccagtaatttcagaaagaggatacagcaaattgttgatcagggattaaagaagcttaaaacatgtgagtctgctgatggagataaggaaccgagtgaccaaattgaattggatatggggcccagaaaaggagaaaattggcgggctgcaagggcttcagctttaggtgatctcattgataagttgaacaaagcccgaaatgaggaggatctacagtcttgcatggagatgaagactcaactcttcaatgaactgaaatctatgagcagctcagaattggaagacacagagac
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

152

Amino Acids

16.9

Weight (kDa)

4.71

Isoelectric Point (pI)

44.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 304
AclWI GGATC 2 cut(s) 73, 378
AcuI CTGAAG 1 cut(s) 303
AfiI CCNNNNNNNGG 2 cut(s) 290, 364
AflIII ACRYGT 1 cut(s) 224
AgsI TTSAA 4 cut(s) 133, 269, 349, 409
AluBI AGCT 4 cut(s) 9, 217, 323, 432
AluI AGCT 4 cut(s) 9, 217, 323, 432
Alw26I GTCTC 2 cut(s) 127, 446
AlwI GGATC 2 cut(s) 73, 378
AoxI GGCC 1 cut(s) 281
ApaI GGGCCC 1 cut(s) 285
ApeKI GCWGC 2 cut(s) 308, 429
AspS9I GGNCC 2 cut(s) 281, 282
AsuHPI GGTGA 2 cut(s) 116, 341
BaeGI GKGCMC 1 cut(s) 285
BanII GRGCYC 1 cut(s) 285
BbsI GAAGAC 2 cut(s) 401, 450
BbvI GCAGC 2 cut(s) 295, 441
BccI CCATC 3 cut(s) 56, 62, 233
BciVI GTATCC 1 cut(s) 177
BclI TGATCA 1 cut(s) 199
BcoDI GTCTC 2 cut(s) 127, 446
BfmI CTRYAG 2 cut(s) 96, 374
BfuI GTATCC 1 cut(s) 177
BisI GCNGC 2 cut(s) 309, 430
BlsI GCNGC 2 cut(s) 310, 431
BmgT120I GGNCC 2 cut(s) 281, 282
BmiI GGNNCC 3 cut(s) 252, 282, 283
BpiI GAAGAC 2 cut(s) 401, 450
BsaI GGTCTC 1 cut(s) 127
Bsc4I CCNNNNNNNGG 2 cut(s) 290, 364
Bse1I ACTGG 1 cut(s) 165
BseGI GGATG 2 cut(s) 67, 68
BseLI CCNNNNNNNGG 2 cut(s) 290, 364
BseMII CTCAG 2 cut(s) 138, 447
BseNI ACTGG 1 cut(s) 165
BseRI GAGGAG 1 cut(s) 380
BseSI GKGCMC 1 cut(s) 285
BseXI GCAGC 2 cut(s) 295, 441
BshFI GGCC 1 cut(s) 283
BslI CCNNNNNNNGG 2 cut(s) 290, 364
BsmAI GTCTC 2 cut(s) 127, 446
BsnI GGCC 1 cut(s) 283
Bso31I GGTCTC 1 cut(s) 127
Bsp120I GGGCCC 1 cut(s) 281
Bsp1286I GDGCHC 1 cut(s) 285
Bsp143I GATC 5 cut(s) 65, 146, 199, 331, 370
BspACI CCGC 1 cut(s) 304
BspANI GGCC 1 cut(s) 283
BspCNI CTCAG 2 cut(s) 137, 446
BspLI GGNNCC 3 cut(s) 252, 282, 283
BspPI GGATC 2 cut(s) 73, 378
BspTNI GGTCTC 1 cut(s) 127
BsrI ACTGG 1 cut(s) 165
BssMI GATC 5 cut(s) 65, 146, 199, 331, 370
Bst4CI ACNGT 1 cut(s) 378
Bst6I CTCTTC 2 cut(s) 42, 410
BstC8I GCNNGC 1 cut(s) 306
BstDEI CTNAG 2 cut(s) 124, 433
BstF5I GGATG 2 cut(s) 67, 68
BstKTI GATC 5 cut(s) 68, 149, 202, 334, 373
BstMAI GTCTC 2 cut(s) 127, 446
BstMBI GATC 5 cut(s) 65, 146, 199, 331, 370
BstMWI GCNNNNNNNGC 1 cut(s) 314
BstNSI RCATGY 1 cut(s) 228
BstSFI CTRYAG 2 cut(s) 96, 374
BstSLI GKGCMC 1 cut(s) 285
BstV1I GCAGC 2 cut(s) 295, 441
BstV2I GAAGAC 2 cut(s) 401, 450
BstX2I RGATCY 1 cut(s) 370
BstYI RGATCY 1 cut(s) 370
BsuI GTATCC 1 cut(s) 177
BsuRI GGCC 1 cut(s) 283
BtsCI GGATG 2 cut(s) 67, 68
Cac8I GCNNGC 1 cut(s) 306
Cfr13I GGNCC 2 cut(s) 281, 282
CviAII CATG 4 cut(s) 83, 88, 225, 385
CviJI RGCY 8 cut(s) 9, 217, 283, 308, 317, 323, 356, 432
CviKI_1 RGCY 8 cut(s) 9, 217, 283, 308, 317, 323, 356, 432
DdeI CTNAG 2 cut(s) 124, 433
DpnI GATC 5 cut(s) 67, 148, 201, 333, 372
DpnII GATC 5 cut(s) 65, 146, 199, 331, 370
Eam1104I CTCTTC 2 cut(s) 42, 410
EarI CTCTTC 2 cut(s) 42, 410
Eco24I GRGCYC 1 cut(s) 285
Eco31I GGTCTC 1 cut(s) 127
Eco57I CTGAAG 1 cut(s) 303
EcoO109I RGGNCCY 1 cut(s) 281
EcoT38I GRGCYC 1 cut(s) 285
FaeI CATG 4 cut(s) 86, 91, 228, 388
FaiI YATR 8 cut(s) 74, 84, 89, 119, 226, 278, 386, 425
FatI CATG 4 cut(s) 82, 87, 224, 384
FauI CCCGC 1 cut(s) 297
FbaI TGATCA 1 cut(s) 199
Fnu4HI GCNGC 2 cut(s) 309, 430
FokI GGATG 2 cut(s) 55, 74
FriOI GRGCYC 1 cut(s) 285
Fsp4HI GCNGC 2 cut(s) 309, 430
GluI GCNGC 2 cut(s) 309, 430
HaeIII GGCC 1 cut(s) 283
Hin1II CATG 4 cut(s) 86, 91, 228, 388
HindIII AAGCTT 1 cut(s) 215
HinfI GANTC 3 cut(s) 50, 230, 397
HphI GGTGA 2 cut(s) 116, 341
Hpy166II GTNNAC 1 cut(s) 34
Hpy188I TCNGA 2 cut(s) 176, 436
Hpy8I GTNNAC 1 cut(s) 34
HpyAV CCTTC 1 cut(s) 95
HpyCH4III ACNGT 1 cut(s) 378
HpyCH4V TGCA 3 cut(s) 44, 311, 384
HpyF10VI GCNNNNNNNGC 1 cut(s) 314
HpyF3I CTNAG 2 cut(s) 124, 433
Hsp92II CATG 4 cut(s) 86, 91, 228, 388
Ksp22I TGATCA 1 cut(s) 199
Kzo9I GATC 5 cut(s) 65, 146, 199, 331, 370
LpnPI CCDG 4 cut(s) 111, 178, 188, 298
Lsp1109I GCAGC 2 cut(s) 295, 441
MaeIII GTNAC 2 cut(s) 104, 257
MalI GATC 5 cut(s) 67, 148, 201, 333, 372
MboI GATC 5 cut(s) 65, 146, 199, 331, 370
MboII GAAGA 4 cut(s) 59, 397, 406, 455
MflI RGATCY 1 cut(s) 370
MhlI GDGCHC 1 cut(s) 285
MluCI AATT 6 cut(s) 169, 192, 264, 269, 298, 437
MlyI GAGTC 3 cut(s) 59, 239, 391
MnlI CCTC 4 cut(s) 10, 174, 358, 361
MseI TTAA 3 cut(s) 137, 209, 219
MslI CAYNNNNRTG 1 cut(s) 389
MwoI GCNNNNNNNGC 1 cut(s) 314
NdeII GATC 5 cut(s) 65, 146, 199, 331, 370
NlaIII CATG 4 cut(s) 86, 91, 228, 388
NlaIV GGNNCC 3 cut(s) 252, 282, 283
NmuCI GTSAC 2 cut(s) 104, 257
NspI RCATGY 1 cut(s) 228
PciI ACATGT 1 cut(s) 224
PkrI GCNGC 2 cut(s) 310, 431
PleI GAGTC 3 cut(s) 58, 238, 391
PpsI GAGTC 3 cut(s) 58, 238, 391
PscI ACATGT 1 cut(s) 224
PspN4I GGNNCC 3 cut(s) 252, 282, 283
PspOMI GGGCCC 1 cut(s) 281
PspPI GGNCC 2 cut(s) 281, 282
PsuI RGATCY 1 cut(s) 370
RseI CAYNNNNRTG 1 cut(s) 389
SaqAI TTAA 3 cut(s) 137, 209, 219
SatI GCNGC 2 cut(s) 309, 430
Sau3AI GATC 5 cut(s) 65, 146, 199, 331, 370
Sau96I GGNCC 2 cut(s) 281, 282
SchI GAGTC 3 cut(s) 59, 239, 391
SduI GDGCHC 1 cut(s) 285
SetI ASST 6 cut(s) 11, 106, 219, 325, 331, 434
SfcI CTRYAG 2 cut(s) 96, 374
SmiMI CAYNNNNRTG 1 cut(s) 389
Sse9I AATT 6 cut(s) 169, 192, 264, 269, 298, 437
SsiI CCGC 1 cut(s) 304
TaaI ACNGT 1 cut(s) 378
TasI AATT 6 cut(s) 169, 192, 264, 269, 298, 437
Tru1I TTAA 3 cut(s) 137, 209, 219
Tru9I TTAA 3 cut(s) 137, 209, 219
TseFI GTSAC 2 cut(s) 104, 257
TseI GCWGC 2 cut(s) 308, 429
Tsp45I GTSAC 2 cut(s) 104, 257
TspDTI ATGAA 2 cut(s) 407, 426
XceI RCATGY 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.