Rmu_co7992216.1_g000001

ZINC FINGER protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7992216.1
Physical Location & Seq
Forward (+)
1 .. 521
521 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7992216.1_g000001.1.cds

Sequence Viewer

Length: 425 bp
cagagatcgagcaaagagatcaagaagagagtctatgtctgccctgaagcttcttgtgtccaccacgatccttctagagctttgggcgatctgactgggattaagaagcacttttgcagaaagcacggggagaagaagtggaaatgcgacaagtgctcgaagaaatacgcggttcagtcggattggaaagctcattctaagatttgtggcaccagagagtataaatgtgattgtgggactttgttttcaaggagggatagcttcataacacacagggctttctgtgatgctttggctgaggaaagtgctagaggtccttctcagactcaaaatgtgaatttgaattcagaatcagacccaaaggttcaaacagtaaattcacctccaccagcagcagcagcacaggcttcagttccatcccaacc

Protein Analysis

142

Amino Acids

15.81

Weight (kDa)

9.29

Isoelectric Point (pI)

52.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 209
AccII CGCG 1 cut(s) 170
AciI CCGC 1 cut(s) 170
AclWI GGATC 1 cut(s) 62
AcsI RAATTY 3 cut(s) 337, 343, 376
AcuI CTGAAG 2 cut(s) 66, 393
AgsI TTSAA 3 cut(s) 249, 343, 368
AluBI AGCT 4 cut(s) 50, 80, 191, 261
AluI AGCT 4 cut(s) 50, 80, 191, 261
Alw21I GWGCWC 1 cut(s) 158
AlwI GGATC 1 cut(s) 62
ApeKI GCWGC 3 cut(s) 392, 395, 398
ApoI RAATTY 3 cut(s) 337, 343, 376
AspS9I GGNCC 1 cut(s) 314
AsuHPI GGTGA 1 cut(s) 372
AvaII GGWCC 1 cut(s) 314
BanI GGYRCC 1 cut(s) 209
Bbv12I GWGCWC 1 cut(s) 158
BbvCI CCTCAGC 1 cut(s) 297
BbvI GCAGC 3 cut(s) 404, 407, 410
BccI CCATC 1 cut(s) 424
BfaI CTAG 2 cut(s) 75, 309
BisI GCNGC 3 cut(s) 393, 396, 399
BlsI GCNGC 3 cut(s) 394, 397, 400
Bme18I GGWCC 1 cut(s) 314
BmgT120I GGNCC 1 cut(s) 314
BmiI GGNNCC 1 cut(s) 211
BmrI ACTGGG 1 cut(s) 105
BmsI GCATC 1 cut(s) 277
BmuI ACTGGG 1 cut(s) 105
Bpu10I CCTNAGC 1 cut(s) 297
BsaXI ACNNNNNCTCC 2 cut(s) 122, 152
Bse1I ACTGG 1 cut(s) 100
BseGI GGATG 1 cut(s) 416
BseMII CTCAG 2 cut(s) 288, 335
BseNI ACTGG 1 cut(s) 100
BseXI GCAGC 3 cut(s) 404, 407, 410
Bsh1236I CGCG 1 cut(s) 170
BshNI GGYRCC 1 cut(s) 209
BsiHKAI GWGCWC 1 cut(s) 158
BslFI GGGAC 1 cut(s) 250
BsmFI GGGAC 1 cut(s) 250
Bsp1286I GDGCHC 1 cut(s) 158
Bsp143I GATC 4 cut(s) 5, 18, 67, 88
BspACI CCGC 1 cut(s) 170
BspCNI CTCAG 2 cut(s) 289, 334
BspFNI CGCG 1 cut(s) 170
BspLI GGNNCC 1 cut(s) 211
BspPI GGATC 1 cut(s) 62
BspT107I GGYRCC 1 cut(s) 209
BsrI ACTGG 1 cut(s) 100
BssMI GATC 4 cut(s) 5, 18, 67, 88
Bst4CI ACNGT 1 cut(s) 373
Bst6I CTCTTC 1 cut(s) 20
BstDEI CTNAG 3 cut(s) 198, 297, 321
BstF5I GGATG 1 cut(s) 416
BstFNI CGCG 1 cut(s) 170
BstKTI GATC 4 cut(s) 8, 21, 70, 91
BstMBI GATC 4 cut(s) 5, 18, 67, 88
BstMWI GCNNNNNNNGC 3 cut(s) 153, 398, 404
BstUI CGCG 1 cut(s) 170
BstV1I GCAGC 3 cut(s) 404, 407, 410
BtsCI GGATG 1 cut(s) 416
Cfr13I GGNCC 1 cut(s) 314
CviJI RGCY 7 cut(s) 50, 80, 191, 261, 278, 296, 407
CviKI_1 RGCY 7 cut(s) 50, 80, 191, 261, 278, 296, 407
DdeI CTNAG 3 cut(s) 198, 297, 321
DpnI GATC 4 cut(s) 7, 20, 69, 90
DpnII GATC 4 cut(s) 5, 18, 67, 88
Eam1104I CTCTTC 1 cut(s) 20
EarI CTCTTC 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 314
Eco57I CTGAAG 2 cut(s) 66, 393
EcoO109I RGGNCCY 1 cut(s) 314
EcoRI GAATTC 1 cut(s) 343
FaiI YATR 3 cut(s) 36, 222, 266
FalI AAGNNNNNCTT 2 cut(s) 95, 127
FaqI GGGAC 1 cut(s) 250
Fnu4HI GCNGC 3 cut(s) 393, 396, 399
FokI GGATG 1 cut(s) 403
Fsp4HI GCNGC 3 cut(s) 393, 396, 399
FspBI CTAG 2 cut(s) 75, 309
GluI GCNGC 3 cut(s) 393, 396, 399
HindIII AAGCTT 1 cut(s) 48
HinfI GANTC 3 cut(s) 30, 325, 350
HphI GGTGA 1 cut(s) 372
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 5 cut(s) 93, 181, 324, 349, 355
Hpy188III TCNNGA 2 cut(s) 22, 75
Hpy8I GTNNAC 1 cut(s) 61
HpyAV CCTTC 2 cut(s) 81, 327
HpyCH4III ACNGT 1 cut(s) 373
HpyCH4V TGCA 1 cut(s) 117
HpyF10VI GCNNNNNNNGC 3 cut(s) 153, 398, 404
HpyF3I CTNAG 3 cut(s) 198, 297, 321
Kzo9I GATC 4 cut(s) 5, 18, 67, 88
LpnPI CCDG 6 cut(s) 57, 81, 226, 259, 389, 402
Lsp1109I GCAGC 3 cut(s) 404, 407, 410
LweI GCATC 1 cut(s) 277
MaeI CTAG 2 cut(s) 75, 309
MalI GATC 4 cut(s) 7, 20, 69, 90
MboI GATC 4 cut(s) 5, 18, 67, 88
MboII GAAGA 3 cut(s) 37, 145, 172
MhlI GDGCHC 1 cut(s) 158
MluCI AATT 3 cut(s) 337, 343, 376
MlyI GAGTC 2 cut(s) 39, 319
MmeI TCCRAC 1 cut(s) 159
MnlI CCTC 4 cut(s) 246, 292, 305, 393
MseI TTAA 1 cut(s) 102
MvnI CGCG 1 cut(s) 170
MwoI GCNNNNNNNGC 3 cut(s) 153, 398, 404
NdeII GATC 4 cut(s) 5, 18, 67, 88
NlaIV GGNNCC 1 cut(s) 211
PfeI GAWTC 1 cut(s) 350
PkrI GCNGC 3 cut(s) 394, 397, 400
PleI GAGTC 2 cut(s) 38, 319
PpsI GAGTC 2 cut(s) 38, 319
PpuMI RGGWCCY 1 cut(s) 314
Psp5II RGGWCCY 1 cut(s) 314
PspN4I GGNNCC 1 cut(s) 211
PspPI GGNCC 1 cut(s) 314
PspPPI RGGWCCY 1 cut(s) 314
SaqAI TTAA 1 cut(s) 102
SatI GCNGC 3 cut(s) 393, 396, 399
Sau3AI GATC 4 cut(s) 5, 18, 67, 88
Sau96I GGNCC 1 cut(s) 314
SchI GAGTC 2 cut(s) 39, 319
SduI GDGCHC 1 cut(s) 158
SetI ASST 7 cut(s) 52, 82, 193, 263, 316, 366, 385
SfaNI GCATC 1 cut(s) 277
SinI GGWCC 1 cut(s) 314
Sse9I AATT 3 cut(s) 337, 343, 376
SsiI CCGC 1 cut(s) 170
SspMI CTAG 2 cut(s) 75, 309
TaaI ACNGT 1 cut(s) 373
TaqI TCGA 2 cut(s) 8, 158
TasI AATT 3 cut(s) 337, 343, 376
TfiI GAWTC 1 cut(s) 350
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TseI GCWGC 3 cut(s) 392, 395, 398
TspDTI ATGAA 1 cut(s) 253
VpaK11BI GGWCC 1 cut(s) 314
XapI RAATTY 3 cut(s) 337, 343, 376
XbaI TCTAGA 1 cut(s) 74
XspI CTAG 2 cut(s) 75, 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.