Rmu_co7999802.1_g000001

ATP synthase subunit O

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7999802.1
Physical Location & Seq
Reverse (-)
17 .. 469
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7999802.1_g000001.1.cds

Sequence Viewer

Length: 453 bp
atggccttcgctaatcgactccgatctagcctccctctccaagtcctcgttagcaagattctcagatcggaaccactctccgccgccgccacccagcgggctgtagtttgccctagtctgacaaaaaataataacaactccgatgagttgtcgaggaactttaattctattgcctctaagaaggatgagaaggtgaagttgcctttggttttgtttggggggtatggaaaatatgcctctgcattgtacattgctgcagcgaaaactgattgcttggacaaagtcgagtctgagattctcgattttgttcagtctatcaagaaaactcctgagctttctcagtttaccaaggatccgacggtgcctgctcgttctagagtgaaggcgatggcggagatttctgaaaaggttgaacattcagatattacaaagaacttcttgggtatgaaataa

Protein Analysis

150

Amino Acids

16.52

Weight (kDa)

9.49

Isoelectric Point (pI)

47.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 361
AciI CCGC 5 cut(s) 81, 84, 87, 97, 392
AclWI GGATC 2 cut(s) 347, 360
AfaI GTAC 1 cut(s) 248
AfiI CCNNNNNNNGG 1 cut(s) 96
AgsI TTSAA 1 cut(s) 413
AjuI GAANNNNNNNTTGG 2 cut(s) 188, 220
AluBI AGCT 1 cut(s) 334
AluI AGCT 1 cut(s) 334
AlwI GGATC 2 cut(s) 347, 360
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 254, 257
AsuHPI GGTGA 1 cut(s) 205
BamHI GGATCC 1 cut(s) 352
BanI GGYRCC 1 cut(s) 361
BbvI GCAGC 2 cut(s) 241, 269
BccI CCATC 1 cut(s) 382
BfaI CTAG 3 cut(s) 27, 114, 375
BfmI CTRYAG 2 cut(s) 102, 255
BisI GCNGC 4 cut(s) 84, 87, 255, 258
BlsI GCNGC 4 cut(s) 85, 88, 256, 259
BmiI GGNNCC 3 cut(s) 72, 354, 363
Bpu10I CCTNAGC 1 cut(s) 330
BsaJI CCNNGG 1 cut(s) 348
Bsc4I CCNNNNNNNGG 1 cut(s) 96
Bse3DI GCAATG 1 cut(s) 249
BseDI CCNNGG 1 cut(s) 348
BseGI GGATG 1 cut(s) 190
BseLI CCNNNNNNNGG 1 cut(s) 96
BseMI GCAATG 1 cut(s) 249
BseMII CTCAG 4 cut(s) 76, 282, 321, 353
BseXI GCAGC 2 cut(s) 241, 269
BseYI CCCAGC 1 cut(s) 93
BshFI GGCC 1 cut(s) 5
BshNI GGYRCC 1 cut(s) 361
BslI CCNNNNNNNGG 1 cut(s) 96
BsnI GGCC 1 cut(s) 5
Bsp1407I TGTACA 1 cut(s) 246
Bsp143I GATC 3 cut(s) 23, 65, 352
BspACI CCGC 5 cut(s) 81, 84, 87, 97, 392
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 4 cut(s) 75, 283, 322, 352
BspLI GGNNCC 3 cut(s) 72, 354, 363
BspMAI CTGCAG 1 cut(s) 259
BspPI GGATC 2 cut(s) 347, 360
BspT107I GGYRCC 1 cut(s) 361
BsrDI GCAATG 1 cut(s) 249
BsrGI TGTACA 1 cut(s) 246
BssECI CCNNGG 1 cut(s) 348
BssMI GATC 3 cut(s) 23, 65, 352
BssT1I CCWWGG 1 cut(s) 348
Bst4CI ACNGT 1 cut(s) 361
BstAUI TGTACA 1 cut(s) 246
BstC8I GCNNGC 2 cut(s) 99, 366
BstDEI CTNAG 5 cut(s) 62, 177, 291, 330, 339
BstF5I GGATG 1 cut(s) 190
BstKTI GATC 3 cut(s) 26, 68, 355
BstMBI GATC 3 cut(s) 23, 65, 352
BstSFI CTRYAG 2 cut(s) 102, 255
BstV1I GCAGC 2 cut(s) 241, 269
BstX2I RGATCY 1 cut(s) 352
BstYI RGATCY 1 cut(s) 352
BsuRI GGCC 1 cut(s) 5
BtgZI GCGATG 1 cut(s) 401
BtsCI GGATG 1 cut(s) 190
Cac8I GCNNGC 2 cut(s) 99, 366
Csp6I GTAC 1 cut(s) 247
CviJI RGCY 4 cut(s) 5, 30, 101, 334
CviKI_1 RGCY 4 cut(s) 5, 30, 101, 334
CviQI GTAC 1 cut(s) 247
DdeI CTNAG 5 cut(s) 62, 177, 291, 330, 339
DpnI GATC 3 cut(s) 25, 67, 354
DpnII GATC 3 cut(s) 23, 65, 352
EciI GGCGGA 2 cut(s) 70, 407
Eco130I CCWWGG 1 cut(s) 348
EcoT14I CCWWGG 1 cut(s) 348
ErhI CCWWGG 1 cut(s) 348
FaiI YATR 3 cut(s) 225, 234, 446
FalI AAGNNNNNCTT 1 cut(s) 422
FauI CCCGC 1 cut(s) 90
Fnu4HI GCNGC 4 cut(s) 84, 87, 255, 258
FokI GGATG 1 cut(s) 197
Fsp4HI GCNGC 4 cut(s) 84, 87, 255, 258
FspBI CTAG 3 cut(s) 27, 114, 375
GluI GCNGC 4 cut(s) 84, 87, 255, 258
GsaI CCCAGC 1 cut(s) 97
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 4 cut(s) 18, 58, 287, 295
HphI GGTGA 1 cut(s) 205
Hpy166II GTNNAC 1 cut(s) 345
Hpy188I TCNGA 9 cut(s) 23, 65, 70, 120, 142, 292, 357, 403, 421
Hpy188III TCNNGA 4 cut(s) 299, 319, 329, 375
Hpy8I GTNNAC 1 cut(s) 345
Hpy99I CGWCG 1 cut(s) 361
HpyAV CCTTC 4 cut(s) 16, 175, 184, 376
HpyCH4III ACNGT 1 cut(s) 361
HpyCH4V TGCA 2 cut(s) 242, 257
HpyF3I CTNAG 5 cut(s) 62, 177, 291, 330, 339
Kzo9I GATC 3 cut(s) 23, 65, 352
LpnPI CCDG 3 cut(s) 107, 342, 378
Lsp1109I GCAGC 2 cut(s) 241, 269
MaeI CTAG 3 cut(s) 27, 114, 375
MalI GATC 3 cut(s) 25, 67, 354
MboI GATC 3 cut(s) 23, 65, 352
MflI RGATCY 1 cut(s) 352
MluCI AATT 1 cut(s) 163
MlyI GAGTC 2 cut(s) 12, 296
MmeI TCCRAC 1 cut(s) 380
MnlI CCTC 6 cut(s) 41, 45, 56, 147, 184, 247
MseI TTAA 1 cut(s) 162
MspA1I CMGCKG 1 cut(s) 97
NdeII GATC 3 cut(s) 23, 65, 352
NlaIV GGNNCC 3 cut(s) 72, 354, 363
PfeI GAWTC 2 cut(s) 58, 295
PflFI GACNNNGTC 1 cut(s) 281
PkrI GCNGC 4 cut(s) 85, 88, 256, 259
PleI GAGTC 2 cut(s) 12, 295
PpsI GAGTC 2 cut(s) 12, 295
PspFI CCCAGC 1 cut(s) 93
PspN4I GGNNCC 3 cut(s) 72, 354, 363
PstI CTGCAG 1 cut(s) 259
PsuI RGATCY 1 cut(s) 352
PsyI GACNNNGTC 1 cut(s) 281
RsaI GTAC 1 cut(s) 248
RsaNI GTAC 1 cut(s) 247
SaqAI TTAA 1 cut(s) 162
SatI GCNGC 4 cut(s) 84, 87, 255, 258
Sau3AI GATC 3 cut(s) 23, 65, 352
SchI GAGTC 2 cut(s) 12, 296
SetI ASST 3 cut(s) 195, 336, 411
SfcI CTRYAG 2 cut(s) 102, 255
Sse9I AATT 1 cut(s) 163
SsiI CCGC 5 cut(s) 81, 84, 87, 97, 392
SspMI CTAG 3 cut(s) 27, 114, 375
StyI CCWWGG 1 cut(s) 348
TaaI ACNGT 1 cut(s) 361
TaqI TCGA 4 cut(s) 16, 152, 285, 300
TasI AATT 1 cut(s) 163
TatI WGTACW 1 cut(s) 246
TauI GCSGC 2 cut(s) 86, 89
TfiI GAWTC 2 cut(s) 58, 295
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TseI GCWGC 2 cut(s) 254, 257
Tth111I GACNNNGTC 1 cut(s) 281
XbaI TCTAGA 1 cut(s) 374
XspI CTAG 3 cut(s) 27, 114, 375
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.