Rmu_co8081082.1_g000001

Destroys radicals which are normally produced within the cells and which are toxic to biological systems

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8081082.1
Physical Location & Seq
Forward (+)
1 .. 551
551 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8081082.1_g000001.1.cds

Sequence Viewer

Length: 254 bp
taggtcctacaactgtgaatgttcgtattactggacttacacctgggcctcatgggttccacttgcatgagtttggtgacacgacaaatggatgcatttccacaggagcacatttcaatcctaaaaacttgactcatggagctcctgaggatgaagtccgtcatgcgggtgacctgggaaacataattgctaatgctgatggagtggcagaggcaacaatcgtggatagccaggtaatatttgaacccagataa
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

8.68

Weight (kDa)

5.26

Isoelectric Point (pI)

9.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011700)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 166
AfiI CCNNNNNNNGG 1 cut(s) 165
AgsI TTSAA 2 cut(s) 117, 244
AjnI CCWGG 3 cut(s) 42, 173, 230
AluBI AGCT 1 cut(s) 142
AluI AGCT 1 cut(s) 142
Alw21I GWGCWC 2 cut(s) 111, 144
AoxI GGCC 1 cut(s) 46
AspS9I GGNCC 2 cut(s) 4, 46
AsuHPI GGTGA 2 cut(s) 88, 181
AvaII GGWCC 1 cut(s) 4
AxyI CCTNAGG 1 cut(s) 146
BanII GRGCYC 1 cut(s) 144
Bbv12I GWGCWC 2 cut(s) 111, 144
BccI CCATC 1 cut(s) 193
BciT130I CCWGG 3 cut(s) 44, 175, 232
Bme1390I CCNGG 3 cut(s) 44, 175, 232
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 2 cut(s) 4, 46
BmiI GGNNCC 1 cut(s) 58
BmrFI CCNGG 3 cut(s) 44, 175, 232
BmsI GCATC 1 cut(s) 82
BsaJI CCNNGG 2 cut(s) 43, 174
Bsc4I CCNNNNNNNGG 1 cut(s) 165
Bse1I ACTGG 1 cut(s) 36
Bse21I CCTNAGG 1 cut(s) 146
BseBI CCWGG 3 cut(s) 44, 175, 232
BseDI CCNNGG 2 cut(s) 43, 174
BseGI GGATG 2 cut(s) 97, 156
BseLI CCNNNNNNNGG 1 cut(s) 165
BseMII CTCAG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 36
BshFI GGCC 1 cut(s) 48
BsiHKAI GWGCWC 2 cut(s) 111, 144
BslI CCNNNNNNNGG 1 cut(s) 165
BsnI GGCC 1 cut(s) 48
Bsp1286I GDGCHC 2 cut(s) 111, 144
BspACI CCGC 1 cut(s) 166
BspANI GGCC 1 cut(s) 48
BspCNI CTCAG 1 cut(s) 138
BspLI GGNNCC 1 cut(s) 58
BsrI ACTGG 1 cut(s) 36
BssECI CCNNGG 2 cut(s) 43, 174
Bst2UI CCWGG 3 cut(s) 44, 175, 232
Bst4CI ACNGT 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 146
BstEII GGTNACC 1 cut(s) 169
BstF5I GGATG 2 cut(s) 97, 156
BstNI CCWGG 3 cut(s) 44, 175, 232
BstPI GGTNACC 1 cut(s) 169
BstSCI CCNGG 3 cut(s) 42, 173, 230
Bsu36I CCTNAGG 1 cut(s) 146
BsuRI GGCC 1 cut(s) 48
BtsCI GGATG 2 cut(s) 97, 156
Cfr13I GGNCC 2 cut(s) 4, 46
CspCI CAANNNNNGTGG 2 cut(s) 203, 238
CviAII CATG 4 cut(s) 52, 67, 136, 163
CviJI RGCY 3 cut(s) 48, 142, 230
CviKI_1 RGCY 3 cut(s) 48, 142, 230
DdeI CTNAG 1 cut(s) 146
Ecl136II GAGCTC 1 cut(s) 142
Eco24I GRGCYC 1 cut(s) 144
Eco47I GGWCC 1 cut(s) 4
Eco53kI GAGCTC 1 cut(s) 142
Eco81I CCTNAGG 1 cut(s) 146
Eco91I GGTNACC 1 cut(s) 169
EcoICRI GAGCTC 1 cut(s) 142
EcoO109I RGGNCCY 1 cut(s) 4
EcoO65I GGTNACC 1 cut(s) 169
EcoRII CCWGG 3 cut(s) 42, 173, 230
EcoT22I ATGCAT 1 cut(s) 97
EcoT38I GRGCYC 1 cut(s) 144
FaeI CATG 4 cut(s) 55, 70, 139, 166
FaiI YATR 5 cut(s) 53, 68, 137, 164, 184
FatI CATG 4 cut(s) 51, 66, 135, 162
FauI CCCGC 1 cut(s) 159
FokI GGATG 2 cut(s) 104, 163
FriOI GRGCYC 1 cut(s) 144
HaeIII GGCC 1 cut(s) 48
Hin1II CATG 4 cut(s) 55, 70, 139, 166
HinfI GANTC 1 cut(s) 132
HphI GGTGA 2 cut(s) 88, 181
Hpy188III TCNNGA 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 15
HpyCH4V TGCA 2 cut(s) 66, 95
HpyF3I CTNAG 1 cut(s) 146
Hsp92II CATG 4 cut(s) 55, 70, 139, 166
LmnI GCTCC 3 cut(s) 106, 139, 147
LpnPI CCDG 9 cut(s) 17, 29, 56, 89, 158, 160, 187, 217, 244
LweI GCATC 1 cut(s) 82
MaeIII GTNAC 2 cut(s) 76, 169
MhlI GDGCHC 2 cut(s) 111, 144
MluCI AATT 1 cut(s) 185
MlyI GAGTC 1 cut(s) 126
MnlI CCTC 3 cut(s) 59, 141, 204
Mph1103I ATGCAT 1 cut(s) 97
MslI CAYNNNNRTG 2 cut(s) 65, 167
MspR9I CCNGG 3 cut(s) 44, 175, 232
MvaI CCWGG 3 cut(s) 44, 175, 232
NlaIII CATG 4 cut(s) 55, 70, 139, 166
NlaIV GGNNCC 1 cut(s) 58
NmuCI GTSAC 2 cut(s) 76, 169
NsiI ATGCAT 1 cut(s) 97
PleI GAGTC 1 cut(s) 126
PpsI GAGTC 1 cut(s) 126
PpuMI RGGWCCY 1 cut(s) 4
Psp124BI GAGCTC 1 cut(s) 144
Psp5II RGGWCCY 1 cut(s) 4
Psp6I CCWGG 3 cut(s) 42, 173, 230
PspEI GGTNACC 1 cut(s) 169
PspGI CCWGG 3 cut(s) 42, 173, 230
PspN4I GGNNCC 1 cut(s) 58
PspPI GGNCC 2 cut(s) 4, 46
PspPPI RGGWCCY 1 cut(s) 4
RseI CAYNNNNRTG 2 cut(s) 65, 167
SacI GAGCTC 1 cut(s) 144
Sau96I GGNCC 2 cut(s) 4, 46
SchI GAGTC 1 cut(s) 126
ScrFI CCNGG 3 cut(s) 44, 175, 232
SduI GDGCHC 2 cut(s) 111, 144
SetI ASST 5 cut(s) 6, 45, 144, 176, 236
SfaNI GCATC 1 cut(s) 82
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 2 cut(s) 65, 167
Sse9I AATT 1 cut(s) 185
SsiI CCGC 1 cut(s) 166
SspI AATATT 1 cut(s) 239
SstI GAGCTC 1 cut(s) 144
StyD4I CCNGG 3 cut(s) 42, 173, 230
TaaI ACNGT 1 cut(s) 15
TasI AATT 1 cut(s) 185
TseFI GTSAC 2 cut(s) 76, 169
Tsp45I GTSAC 2 cut(s) 76, 169
TspDTI ATGAA 1 cut(s) 167
TspGWI ACGGA 1 cut(s) 148
VpaK11BI GGWCC 1 cut(s) 4
Zsp2I ATGCAT 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.