Rmu_co8121482.1_g000001

RNA recognition motif

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8121482.1
Physical Location & Seq
Forward (+)
70 .. 620
551 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8121482.1_g000001.1.cds

Sequence Viewer

Length: 551 bp
atggccgaggagcaaatagattatgaagaggaggagtatggaggtgctcagaagctccaatatcaggaaagtggagccatacctgctcttgctgatgaagaaccgatggtagaagatgacgagtatgacgatctctacaatgatgttaatgttggagaaggtttcctgcagatgcaccgacctgaggcaccacacccacctgctggtgttggcaatggaggactccaagctcagaaaaataatgttcctgaagtaagagttcaagctggtgtttctcaggaactgaaaaatccgggattttcagttgaaggaaagtattctagtgttcctgaacagaaggatcagcccccagtgtctaaggtgccagaactgggatctcaaaaggggagggttatggagatgactcatgatgctcaagtcaggaatatgggttttcaggggacagcaactatgccgtccaatgttggtgttgattcttcttcagatcttactgggaaaattgccaatgggcctattccatcaatgaattctagcactactggtcctccagc

Protein Analysis

184

Amino Acids

19.69

Weight (kDa)

4.31

Isoelectric Point (pI)

54.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 208
Acc36I ACCTGC 2 cut(s) 91, 208
AccB1I GGYRCC 2 cut(s) 187, 361
AccB7I CCANNNNNTGG 1 cut(s) 203
AclWI GGATC 2 cut(s) 348, 382
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 526
AcuI CTGAAG 2 cut(s) 270, 465
AfiI CCNNNNNNNGG 4 cut(s) 64, 184, 203, 371
AgsI TTSAA 2 cut(s) 263, 308
AluBI AGCT 3 cut(s) 55, 230, 266
AluI AGCT 3 cut(s) 55, 230, 266
Alw21I GWGCWC 1 cut(s) 49
AlwI GGATC 2 cut(s) 348, 382
AlwNI CAGNNNCTG 1 cut(s) 283
AoxI GGCC 2 cut(s) 3, 509
ApoI RAATTY 1 cut(s) 526
Asp700I GAANNNNTTC 1 cut(s) 316
AspS9I GGNCC 2 cut(s) 509, 542
AsuC2I CCSGG 1 cut(s) 294
AvaII GGWCC 1 cut(s) 542
AxyI CCTNAGG 1 cut(s) 183
BanI GGYRCC 2 cut(s) 187, 361
Bbv12I GWGCWC 1 cut(s) 49
BccI CCATC 2 cut(s) 100, 526
BceAI ACGGC 1 cut(s) 439
BcnI CCSGG 1 cut(s) 294
BfaI CTAG 2 cut(s) 321, 531
BfmI CTRYAG 1 cut(s) 167
BfuAI ACCTGC 2 cut(s) 91, 208
BglII AGATCT 1 cut(s) 484
Bme1390I CCNGG 1 cut(s) 294
Bme18I GGWCC 1 cut(s) 542
BmgT120I GGNCC 2 cut(s) 509, 542
BmiI GGNNCC 3 cut(s) 76, 189, 363
BmrFI CCNGG 1 cut(s) 294
BmrI ACTGGG 3 cut(s) 344, 380, 501
BmsI GCATC 2 cut(s) 162, 400
BmuI ACTGGG 3 cut(s) 344, 380, 501
BpmI CTGGAG 1 cut(s) 531
BpuEI CTTGAG 1 cut(s) 399
BpuMI CCSGG 1 cut(s) 294
BsaJI CCNNGG 1 cut(s) 6
BsaXI ACNNNNNCTCC 1 cut(s) 529
Bsc4I CCNNNNNNNGG 4 cut(s) 64, 184, 203, 371
Bse1I ACTGG 4 cut(s) 350, 375, 496, 544
Bse21I CCTNAGG 1 cut(s) 183
Bse3DI GCAATG 1 cut(s) 220
BseDI CCNNGG 1 cut(s) 6
BseLI CCNNNNNNNGG 4 cut(s) 64, 184, 203, 371
BseMI GCAATG 1 cut(s) 220
BseMII CTCAG 4 cut(s) 62, 174, 245, 290
BseNI ACTGG 4 cut(s) 350, 375, 496, 544
BseRI GAGGAG 3 cut(s) 23, 44, 47
BshFI GGCC 2 cut(s) 5, 511
BshNI GGYRCC 2 cut(s) 187, 361
BsiHKAI GWGCWC 1 cut(s) 49
BsiSI CCGG 1 cut(s) 293
BslFI GGGAC 1 cut(s) 454
BslI CCNNNNNNNGG 4 cut(s) 64, 184, 203, 371
BsmFI GGGAC 1 cut(s) 454
BsnI GGCC 2 cut(s) 5, 511
Bsp1286I GDGCHC 1 cut(s) 49
Bsp143I GATC 4 cut(s) 130, 340, 374, 484
BspANI GGCC 2 cut(s) 5, 511
BspCNI CTCAG 4 cut(s) 61, 175, 244, 289
BspHI TCATGA 1 cut(s) 406
BspLI GGNNCC 3 cut(s) 76, 189, 363
BspMAI CTGCAG 1 cut(s) 171
BspMI ACCTGC 2 cut(s) 91, 208
BspPI GGATC 2 cut(s) 348, 382
BspT107I GGYRCC 2 cut(s) 187, 361
BsrDI GCAATG 1 cut(s) 220
BsrI ACTGG 4 cut(s) 350, 375, 496, 544
BssECI CCNNGG 1 cut(s) 6
BssMI GATC 4 cut(s) 130, 340, 374, 484
Bst6I CTCTTC 1 cut(s) 21
BstDEI CTNAG 5 cut(s) 48, 183, 231, 276, 357
BstKTI GATC 4 cut(s) 133, 343, 377, 487
BstMBI GATC 4 cut(s) 130, 340, 374, 484
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstSCI CCNGG 1 cut(s) 292
BstSFI CTRYAG 1 cut(s) 167
BstX2I RGATCY 2 cut(s) 374, 484
BstYI RGATCY 2 cut(s) 374, 484
Bsu36I CCTNAGG 1 cut(s) 183
BsuRI GGCC 2 cut(s) 5, 511
BtsIMutI CAGTG 1 cut(s) 357
BveI ACCTGC 2 cut(s) 91, 208
CaiI CAGNNNCTG 1 cut(s) 283
CciI TCATGA 1 cut(s) 406
Cfr13I GGNCC 2 cut(s) 509, 542
CviAII CATG 1 cut(s) 407
CviJI RGCY 7 cut(s) 5, 55, 77, 230, 266, 346, 511
CviKI_1 RGCY 7 cut(s) 5, 55, 77, 230, 266, 346, 511
DdeI CTNAG 5 cut(s) 48, 183, 231, 276, 357
DpnI GATC 4 cut(s) 132, 342, 376, 486
DpnII GATC 4 cut(s) 130, 340, 374, 484
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 21
EarI CTCTTC 1 cut(s) 21
Eco47I GGWCC 1 cut(s) 542
Eco57I CTGAAG 2 cut(s) 270, 465
Eco81I CCTNAGG 1 cut(s) 183
EcoRI GAATTC 1 cut(s) 526
FaeI CATG 1 cut(s) 410
FaiI YATR 8 cut(s) 24, 39, 80, 126, 395, 408, 428, 452
FaqI GGGAC 1 cut(s) 454
FatI CATG 1 cut(s) 406
FspBI CTAG 2 cut(s) 321, 531
GsuI CTGGAG 1 cut(s) 531
HaeIII GGCC 2 cut(s) 5, 511
HapII CCGG 1 cut(s) 293
Hin1II CATG 1 cut(s) 410
HinfI GANTC 3 cut(s) 222, 403, 473
HpaII CCGG 1 cut(s) 293
Hpy188I TCNGA 3 cut(s) 51, 234, 484
Hpy188III TCNNGA 6 cut(s) 65, 248, 278, 329, 407, 421
HpyAV CCTTC 3 cut(s) 152, 302, 331
HpyCH4V TGCA 2 cut(s) 169, 175
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 5 cut(s) 48, 183, 231, 276, 357
Hsp92II CATG 1 cut(s) 410
Kzo9I GATC 4 cut(s) 130, 340, 374, 484
LmnI GCTCC 3 cut(s) 10, 60, 74
LweI GCATC 2 cut(s) 162, 400
MaeI CTAG 2 cut(s) 321, 531
MalI GATC 4 cut(s) 132, 342, 376, 486
MboI GATC 4 cut(s) 130, 340, 374, 484
MboII GAAGA 5 cut(s) 38, 110, 125, 468, 471
MflI RGATCY 2 cut(s) 374, 484
MhlI GDGCHC 1 cut(s) 49
MluCI AATT 2 cut(s) 498, 526
MlyI GAGTC 2 cut(s) 216, 397
MmeI TCCRAC 1 cut(s) 133
MnlI CCTC 6 cut(s) 22, 25, 35, 178, 212, 381
MroXI GAANNNNTTC 1 cut(s) 316
MseI TTAA 1 cut(s) 147
MspI CCGG 1 cut(s) 293
MspR9I CCNGG 1 cut(s) 294
MwoI GCNNNNNNNGC 1 cut(s) 83
NciI CCSGG 1 cut(s) 294
NdeII GATC 4 cut(s) 130, 340, 374, 484
NlaIII CATG 1 cut(s) 410
NlaIV GGNNCC 3 cut(s) 76, 189, 363
NmeAIII GCCGAG 1 cut(s) 31
PagI TCATGA 1 cut(s) 406
PaqCI CACCTGC 1 cut(s) 208
PcsI WCGNNNNNNNCGW 1 cut(s) 126
PdmI GAANNNNTTC 1 cut(s) 316
PfeI GAWTC 1 cut(s) 473
PflMI CCANNNNNTGG 1 cut(s) 203
PfoI TCCNGGA 1 cut(s) 292
PleI GAGTC 2 cut(s) 216, 397
PpsI GAGTC 2 cut(s) 216, 397
PspN4I GGNNCC 3 cut(s) 76, 189, 363
PspPI GGNCC 2 cut(s) 509, 542
PstI CTGCAG 1 cut(s) 171
PstNI CAGNNNCTG 1 cut(s) 283
PsuI RGATCY 2 cut(s) 374, 484
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 4 cut(s) 130, 340, 374, 484
Sau96I GGNCC 2 cut(s) 509, 542
SchI GAGTC 2 cut(s) 216, 397
ScrFI CCNGG 1 cut(s) 294
SduI GDGCHC 1 cut(s) 49
SetI ASST 9 cut(s) 46, 57, 85, 163, 184, 202, 232, 268, 363
SfaNI GCATC 2 cut(s) 162, 400
SfcI CTRYAG 1 cut(s) 167
SinI GGWCC 1 cut(s) 542
SmlI CTYRAG 1 cut(s) 414
SmoI CTYRAG 1 cut(s) 414
Sse9I AATT 2 cut(s) 498, 526
SspMI CTAG 2 cut(s) 321, 531
StyD4I CCNGG 1 cut(s) 292
TasI AATT 2 cut(s) 498, 526
TfiI GAWTC 1 cut(s) 473
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 1 cut(s) 357
TspDTI ATGAA 3 cut(s) 39, 111, 539
TspRI CASTG 1 cut(s) 357
Van91I CCANNNNNTGG 1 cut(s) 203
VpaK11BI GGWCC 1 cut(s) 542
XapI RAATTY 1 cut(s) 526
XmnI GAANNNNTTC 1 cut(s) 316
XspI CTAG 2 cut(s) 321, 531
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.