Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001084.1

Orthogroup ID

OG0002110

Physical Location & Seq

Genomic Coordinates Forward (+)

158559 .. 160442

Gene Structure 1884 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001084.1_g000038.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1884 bp

atggctgaggagcagataaattttgaagaggaggaatatggaggtgctcagaagctccaatatcagggaagtggagccatatctgcgcttgcggatgaagaaccgatggttgaagatgatgagtacgacgatctatatgatgatgttaatgttggagagggtttcctgcagatgcatcgatctgaggcaccagtccctgctggtggtcttgggaatggaggactccaagctcagaaaactgatgttcctgaactaagagttcaagccggtgcttctcaggaaatgaaaattccgggggtttcagttggaggaaattattctagtgttcctgaacagaaggttcagccaccagtcgctaatgtgcctgaaactcaagtcaggcatatggggtttcaggggtcaacaactatgccctccaatgttggtgctgattctttggaaattactgcaaaatttgctaacgagcctcttccatcaatgaattctggcaccactggtccttcagctgttacacaggtgcctgctaatcaaatgaatatcaaggtcaatcttaatcgtccaatggctaatgaaaaccaaatccgtcctccaattgagaatggttcggccacgttgtttgtgggagatttacattggtggacaactgatgctgaactggaaagtgttttatctcagtttgggagggtgaaggaaattaagttttttgatgaaagagccagtggtaaatccaaaggttattgtcaggtagatttttatgatcccgcagctgccagtgcatgcaaagagggaatggatggttatgttttcaatgggagagcttgtgttgtggcctttgctacttcacaaactttaaagcagatgggagctaattatgtgaacaaatcccaagggcaggttcaaactcagctccaagggagaaggcccatgaatgatggtgctgggagagggggaggcatgaattttcaaggtggagacacggggagaaattttgggaggggtaattgggggcgaggtggacagggagtacccaacagaggtcctggtggaccagggcggggaagaggaggggccatgggtgcaaagaacatggttgggaataatgctggggttggagctggtgctaatggaggaggctatggacagggccttgcaggtcctggatttggcggtcctgtgggaggtatgatgaatgcacctggtatgatgggtcctgggtttgatccaacatatatgggtcgaggaggtggttacggagggttccctggtcctggttttcctggaatgcttcctcaatttcctggtgttaatgcaatgggacttgctggggttgctcctcatgtaaacccagctttctttggcaggggaatggcaacgaatgggatggggatgatgggttcttctggaatggaggtgcatcatgcccctatgtggagtgatccaagtatgggagggtggggaggagaagaacaggatcgaagaactagggagtcaagctatgggggtgatgatggtgcttctgagtatggaaactatgtagaggcaaatcatgagaaatcagctaagtcaagtgctgcctcaagggaaagagaacggggatctgagcgtgagtggacaggaacctctgagaggaggcatcgtgatgagagagaacaagacttggacaggtctgaaagggagcaccgggagcccaggtataaagaagaaaaagatagttacagagatcatcgtcgaagagagcgtgacgtgggttatgatgatgactgggacagaggacaatcttcttcaagacctcacagtaggtccaaagcaatgccggaagatgatcatcgttctcgatcaagggatgtggattatgggaagaggagacgattgccatctgagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003729 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0097159 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko03015 map03015

Pfam Domains

Protein Families

RRM_1

Protein Analysis

627

Amino Acids

67.31

Weight (kDa)

5.45

Isoelectric Point (pI)

49.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002110)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G13190
fragaria_vesca	FvH4_3g29240 FvH4_4g25160 FvH4_4g25160 FvH4_4g25160 FvH4_4g25160 FvH4_4g25170 FvH4_4g25170
malus_domestica	MD13G1106000.v1.1 MD16G1106200.v1.1
prunus_persica	Prupe.1G240200_v2.0.a1 Prupe.1G240200_v2.0.a1 Prupe.1G240200_v2.0.a1 Prupe.1G240200_v2.0.a1 Prupe.1G240200_v2.0.a1 Prupe.1G240200_v2.0.a1
pyrus_communis	pycom13g09200 pycom16g09030
rosa_chinensis	RchiOBHm_Chr4g0432361 RchiOBHm_Chr4g0432371
rosa_laevigata	RLG00000006849 RLG00000006850
rosa_multiflora	Rmu_co8121482.1_g000001 Rmu_sc0001084.1_g000036 Rmu_sc0001084.1_g000038 Rmu_sc0016445.1_g000013
rosa_roxburghii	Rroxscaffold_5G00373810 Rroxscaffold_5G00373820
rosa_rugosa	Rorug04G0257400 Rorug04G0257500 Rorug04G0257600 Rorug04G0257700.1 Rorug04G0257800 Rorug04G0257900
rosa_samantha	Rh4AG313700 Rh4AG313800 Rh4BG321100 Rh4BG321300 Rh4CG336300 Rh4CG336400 Rh4DG316800 Rh4DG316900
rosa_wichuraiana	Rw4G027260 Rw4G027270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	883, 1142
AccB1I	GGYRCC	3 cut(s)	187, 488, 517
AciI	CCGC	4 cut(s)	92, 762, 1054, 1167
AclWI	GGATC	5 cut(s)	752, 1214, 1430, 1479, 1603
AcoI	YGGCCR	1 cut(s)	606
AcsI	RAATTY	6 cut(s)	19, 288, 452, 481, 958, 985
AcuI	CTGAAG	1 cut(s)	486
AfaI	GTAC	2 cut(s)	125, 1026
AgsI	TTSAA	7 cut(s)	26, 113, 263, 808, 899, 965, 1785
AjiI	CACGTC	1 cut(s)	1744
AjuI	GAANNNNNNNTTGG	2 cut(s)	879, 911
AloI	GAACNNNNNNTCC	2 cut(s)	1378, 1410
Alw21I	GWGCWC	2 cut(s)	49, 1680
Alw26I	GTCTC	2 cut(s)	966, 1858
AlwI	GGATC	5 cut(s)	752, 1214, 1430, 1479, 1603
AlwNI	CAGNNNCTG	2 cut(s)	197, 1157
AoxI	GGCC	5 cut(s)	606, 828, 920, 1068, 1144
ApeKI	GCWGC	3 cut(s)	764, 767, 1571
ApoI	RAATTY	6 cut(s)	19, 288, 452, 481, 958, 985
Asp700I	GAANNNNTTC	1 cut(s)	316
AspLEI	GCGC	1 cut(s)	88
AsuC2I	CCSGG	2 cut(s)	294, 1682
AsuHPI	GGTGA	2 cut(s)	697, 1514
AvaII	GGWCC	8 cut(s)	497, 1037, 1046, 1154, 1169, 1208, 1265, 1800
BanI	GGYRCC	3 cut(s)	187, 488, 517
BanII	GRGCYC	1 cut(s)	1689
Bbv12I	GWGCWC	2 cut(s)	49, 1680
BbvCI	CCTCAGC	1 cut(s)	6
BbvI	GCAGC	3 cut(s)	754, 776, 1558
BcgI	CGANNNNNNTGC	2 cut(s)	158, 192
BclI	TGATCA	1 cut(s)	1822
BcnI	CCSGG	2 cut(s)	294, 1682
BcoDI	GTCTC	2 cut(s)	966, 1858
BfaI	CTAG	2 cut(s)	321, 1482
BfmI	CTRYAG	1 cut(s)	167
BfuAI	ACCTGC	2 cut(s)	883, 1142
BisI	GCNGC	3 cut(s)	765, 768, 1572
BlsI	GCNGC	3 cut(s)	766, 769, 1573
Bme18I	GGWCC	8 cut(s)	497, 1037, 1046, 1154, 1169, 1208, 1265, 1800
BmgBI	CACGTC	1 cut(s)	1744
BmiI	GGNNCC	9 cut(s)	76, 189, 490, 519, 1069, 1209, 1259, 1618, 1686
BmrI	ACTGGG	1 cut(s)	1771
BmsI	GCATC	5 cut(s)	162, 184, 637, 1423, 1642
BmuI	ACTGGG	1 cut(s)	1771
Bpu10I	CCTNAGC	1 cut(s)	6
BpuEI	CTTGAG	2 cut(s)	357, 1561
BpuMI	CCSGG	2 cut(s)	294, 1682
Bsa29I	ATCGAT	1 cut(s)	178
BsaBI	GATNNNNATC	2 cut(s)	1824, 1873
BsaJI	CCNNGG	8 cut(s)	293, 886, 910, 1049, 1071, 1211, 1261, 1688
BsaXI	ACNNNNNCTCC	6 cut(s)	805, 835, 1621, 1651, 1676, 1706
Bse118I	RCCGGY	1 cut(s)	266
Bse1I	ACTGG	7 cut(s)	191, 350, 499, 660, 717, 771, 1766
Bse3DI	GCAATG	2 cut(s)	1317, 1815
Bse8I	GATNNNNATC	2 cut(s)	1824, 1873
BseCI	ATCGAT	1 cut(s)	178
BseDI	CCNNGG	8 cut(s)	293, 886, 910, 1049, 1071, 1211, 1261, 1688
BseGI	GGATG	5 cut(s)	100, 799, 1386, 1392, 1849
BseJI	GATNNNNATC	2 cut(s)	1824, 1873
BseMI	GCAATG	2 cut(s)	1317, 1815
BseNI	ACTGG	7 cut(s)	191, 350, 499, 660, 717, 771, 1766
BseRI	GAGGAG	9 cut(s)	23, 44, 1077, 1143, 1254, 1323, 1473, 1642, 1876
BseXI	GCAGC	3 cut(s)	754, 776, 1558
BseYI	CCCAGC	4 cut(s)	938, 1103, 1322, 1345
BshFI	GGCC	5 cut(s)	608, 830, 922, 1070, 1146
BshNI	GGYRCC	3 cut(s)	187, 488, 517
BshVI	ATCGAT	1 cut(s)	178
BsiHKAI	GWGCWC	2 cut(s)	49, 1680
BsiSI	CCGG	4 cut(s)	267, 293, 1681, 1814
BslFI	GGGAC	3 cut(s)	179, 1329, 1778
BsmAI	GTCTC	2 cut(s)	966, 1858
BsmBI	CGTCTC	1 cut(s)	1858
BsmFI	GGGAC	3 cut(s)	179, 1329, 1778
BsmI	GAATGC	2 cut(s)	1195, 1287
BsnI	GGCC	5 cut(s)	608, 830, 922, 1070, 1146
Bsp1286I	GDGCHC	3 cut(s)	49, 1680, 1689
Bsp19I	CCATGG	1 cut(s)	1071
BspACI	CCGC	4 cut(s)	92, 762, 1054, 1167
BspANI	GGCC	5 cut(s)	608, 830, 922, 1070, 1146
BspDI	ATCGAT	1 cut(s)	178
BspHI	TCATGA	1 cut(s)	1546
BspLI	GGNNCC	9 cut(s)	76, 189, 490, 519, 1069, 1209, 1259, 1618, 1686
BspMAI	CTGCAG	1 cut(s)	171
BspMI	ACCTGC	2 cut(s)	883, 1142
BspPI	GGATC	5 cut(s)	752, 1214, 1430, 1479, 1603
BspT107I	GGYRCC	3 cut(s)	187, 488, 517
BsrDI	GCAATG	2 cut(s)	1317, 1815
BsrFI	RCCGGY	1 cut(s)	266
BsrI	ACTGG	7 cut(s)	191, 350, 499, 660, 717, 771, 1766
BssAI	RCCGGY	1 cut(s)	266
BssECI	CCNNGG	8 cut(s)	293, 886, 910, 1049, 1071, 1211, 1261, 1688
BssT1I	CCWWGG	3 cut(s)	886, 910, 1071
Bst4CI	ACNGT	1 cut(s)	1796
Bst6I	CTCTTC	5 cut(s)	21, 474, 1054, 1726, 1853
BstAPI	GCANNNNNTGC	1 cut(s)	455
BstC8I	GCNNGC	3 cut(s)	90, 522, 778
BstDSI	CCRYGG	1 cut(s)	1071
BstENI	CCTNNNNNAGG	2 cut(s)	1176, 1624
BstF5I	GGATG	5 cut(s)	100, 799, 1386, 1392, 1849
BstHHI	GCGC	1 cut(s)	88
BstMAI	GTCTC	2 cut(s)	966, 1858
BstMWI	GCNNNNNNNGC	6 cut(s)	83, 455, 773, 1076, 1328, 1684
BstNSI	RCATGY	1 cut(s)	780
BstSFI	CTRYAG	1 cut(s)	167
BstV1I	GCAGC	3 cut(s)	754, 776, 1558
BstX2I	RGATCY	1 cut(s)	1595
BstYI	RGATCY	1 cut(s)	1595
Bsu15I	ATCGAT	1 cut(s)	178
BsuRI	GGCC	5 cut(s)	608, 830, 922, 1070, 1146
BsuTUI	ATCGAT	1 cut(s)	178
BtgI	CCRYGG	1 cut(s)	1071
BtrI	CACGTC	1 cut(s)	1744
BtsCI	GGATG	5 cut(s)	100, 799, 1386, 1392, 1849
BtsIMutI	CAGTG	3 cut(s)	492, 724, 778
BveI	ACCTGC	2 cut(s)	883, 1142
Cac8I	GCNNGC	3 cut(s)	90, 522, 778
CaiI	CAGNNNCTG	2 cut(s)	197, 1157
CciI	TCATGA	1 cut(s)	1546
CfoI	GCGC	1 cut(s)	88
Cfr10I	RCCGGY	1 cut(s)	266
ClaI	ATCGAT	1 cut(s)	178
CsiI	ACCWGGT	1 cut(s)	1195
Csp6I	GTAC	2 cut(s)	124, 1025
CspCI	CAANNNNNGTGG	4 cut(s)	598, 633, 1827, 1862
CviAII	CATG	8 cut(s)	777, 925, 955, 1072, 1087, 1337, 1418, 1547
CviQI	GTAC	2 cut(s)	124, 1025
DraI	TTTAAA	1 cut(s)	852
EaeI	YGGCCR	1 cut(s)	606
Eam1104I	CTCTTC	5 cut(s)	21, 474, 1054, 1726, 1853
EarI	CTCTTC	5 cut(s)	21, 474, 1054, 1726, 1853
Eco130I	CCWWGG	3 cut(s)	886, 910, 1071
Eco24I	GRGCYC	1 cut(s)	1689
Eco47I	GGWCC	8 cut(s)	497, 1037, 1046, 1154, 1169, 1208, 1265, 1800
Eco57I	CTGAAG	1 cut(s)	486
EcoNI	CCTNNNNNAGG	2 cut(s)	1176, 1624
EcoO109I	RGGNCCY	4 cut(s)	1037, 1144, 1154, 1208
EcoRI	GAATTC	1 cut(s)	481
EcoT14I	CCWWGG	3 cut(s)	886, 910, 1071
EcoT22I	ATGCAT	1 cut(s)	177
EcoT38I	GRGCYC	1 cut(s)	1689
ErhI	CCWWGG	3 cut(s)	886, 910, 1071
Esp3I	CGTCTC	1 cut(s)	1858
FaeI	CATG	8 cut(s)	780, 928, 958, 1075, 1090, 1340, 1421, 1550
FaqI	GGGAC	3 cut(s)	179, 1329, 1778
FatI	CATG	8 cut(s)	776, 924, 954, 1071, 1086, 1336, 1417, 1546
FauI	CCCGC	2 cut(s)	769, 1047
FauNDI	CATATG	1 cut(s)	384
FbaI	TGATCA	1 cut(s)	1822
Fnu4HI	GCNGC	3 cut(s)	765, 768, 1572
FokI	GGATG	5 cut(s)	107, 806, 1393, 1399, 1856
FriOI	GRGCYC	1 cut(s)	1689
Fsp4HI	GCNGC	3 cut(s)	765, 768, 1572
FspBI	CTAG	2 cut(s)	321, 1482
GlaI	GCGC	1 cut(s)	87
GluI	GCNGC	3 cut(s)	765, 768, 1572
GsaI	CCCAGC	4 cut(s)	942, 1107, 1326, 1349
HaeIII	GGCC	5 cut(s)	608, 830, 922, 1070, 1146
HapII	CCGG	4 cut(s)	267, 293, 1681, 1814
HhaI	GCGC	1 cut(s)	88
Hin1II	CATG	8 cut(s)	780, 928, 958, 1075, 1090, 1340, 1421, 1550
Hin6I	GCGC	1 cut(s)	86
HinP1I	GCGC	1 cut(s)	86
HincII	GTYRAC	1 cut(s)	402
HindII	GTYRAC	1 cut(s)	402
HinfI	GANTC	3 cut(s)	222, 431, 1487
HpaII	CCGG	4 cut(s)	267, 293, 1681, 1814
HphI	GGTGA	2 cut(s)	697, 1514
Hpy166II	GTNNAC	7 cut(s)	402, 639, 877, 1016, 1046, 1342, 1611
Hpy188I	TCNGA	8 cut(s)	51, 184, 234, 1519, 1600, 1624, 1669, 1879
Hpy188III	TCNNGA	8 cut(s)	248, 278, 329, 1401, 1547, 1637, 1785, 1833
Hpy8I	GTNNAC	7 cut(s)	402, 639, 877, 1016, 1046, 1342, 1611
Hpy99I	CGWCG	2 cut(s)	131, 1731
HpyAV	CCTTC	4 cut(s)	331, 510, 682, 912
HpyCH4III	ACNGT	1 cut(s)	1796
HpyCH4IV	ACGT	2 cut(s)	611, 1743
HpyF10VI	GCNNNNNNNGC	6 cut(s)	83, 455, 773, 1076, 1328, 1684
HpySE526I	ACGT	2 cut(s)	611, 1743
Hsp92II	CATG	8 cut(s)	780, 928, 958, 1075, 1090, 1340, 1421, 1550
HspAI	GCGC	1 cut(s)	86
Ksp22I	TGATCA	1 cut(s)	1822
LmnI	GCTCC	9 cut(s)	10, 60, 74, 863, 912, 1112, 1336, 1675, 1684
Lsp1109I	GCAGC	3 cut(s)	754, 776, 1558
LweI	GCATC	5 cut(s)	162, 184, 637, 1423, 1642
MabI	ACCWGGT	1 cut(s)	1195
MaeI	CTAG	2 cut(s)	321, 1482
MaeII	ACGT	2 cut(s)	611, 1743
MaeIII	GTNAC	4 cut(s)	508, 1247, 1712, 1739
MfeI	CAATTG	1 cut(s)	591
MflI	RGATCY	1 cut(s)	1595
MhlI	GDGCHC	3 cut(s)	49, 1680, 1689
MlyI	GAGTC	2 cut(s)	216, 1496
MmeI	TCCRAC	4 cut(s)	133, 286, 1090, 1247
Mph1103I	ATGCAT	1 cut(s)	177
MroXI	GAANNNNTTC	1 cut(s)	316
MseI	TTAA	5 cut(s)	147, 552, 696, 851, 1305
MslI	CAYNNNNRTG	2 cut(s)	1638, 1879
MspA1I	CMGCKG	2 cut(s)	506, 767
MspI	CCGG	4 cut(s)	267, 293, 1681, 1814
MunI	CAATTG	1 cut(s)	591
Mva1269I	GAATGC	2 cut(s)	1195, 1287
MwoI	GCNNNNNNNGC	6 cut(s)	83, 455, 773, 1076, 1328, 1684
NciI	CCSGG	2 cut(s)	294, 1682
NcoI	CCATGG	1 cut(s)	1071
NdeI	CATATG	1 cut(s)	384
NlaIII	CATG	8 cut(s)	780, 928, 958, 1075, 1090, 1340, 1421, 1550
NlaIV	GGNNCC	9 cut(s)	76, 189, 490, 519, 1069, 1209, 1259, 1618, 1686
NmuCI	GTSAC	1 cut(s)	1739
NsiI	ATGCAT	1 cut(s)	177
NspI	RCATGY	1 cut(s)	780
PaeI	GCATGC	1 cut(s)	780
PagI	TCATGA	1 cut(s)	1546
PcsI	WCGNNNNNNNCGW	1 cut(s)	1735
PctI	GAATGC	2 cut(s)	1195, 1287
PdmI	GAANNNNTTC	1 cut(s)	316
PfeI	GAWTC	1 cut(s)	431
PfoI	TCCNGGA	2 cut(s)	1156, 1276
PkrI	GCNGC	3 cut(s)	766, 769, 1573
PleI	GAGTC	2 cut(s)	216, 1495
PpsI	GAGTC	2 cut(s)	216, 1495
PpuMI	RGGWCCY	3 cut(s)	1037, 1154, 1208
Psp5II	RGGWCCY	3 cut(s)	1037, 1154, 1208
PspFI	CCCAGC	4 cut(s)	938, 1103, 1322, 1345
PspN4I	GGNNCC	9 cut(s)	76, 189, 490, 519, 1069, 1209, 1259, 1618, 1686
PspPPI	RGGWCCY	3 cut(s)	1037, 1154, 1208
PstI	CTGCAG	1 cut(s)	171
PstNI	CAGNNNCTG	2 cut(s)	197, 1157
PsuI	RGATCY	1 cut(s)	1595
PvuII	CAGCTG	2 cut(s)	506, 767
RsaI	GTAC	2 cut(s)	125, 1026
RsaNI	GTAC	2 cut(s)	124, 1025
RseI	CAYNNNNRTG	2 cut(s)	1638, 1879
SaqAI	TTAA	5 cut(s)	147, 552, 696, 851, 1305
SatI	GCNGC	3 cut(s)	765, 768, 1572
SchI	GAGTC	2 cut(s)	216, 1496
SduI	GDGCHC	3 cut(s)	49, 1680, 1689
SexAI	ACCWGGT	1 cut(s)	1195
SfaNI	GCATC	5 cut(s)	162, 184, 637, 1423, 1642
SfcI	CTRYAG	1 cut(s)	167
SinI	GGWCC	8 cut(s)	497, 1037, 1046, 1154, 1169, 1208, 1265, 1800
SmiMI	CAYNNNNRTG	2 cut(s)	1638, 1879
SmlI	CTYRAG	2 cut(s)	372, 1576
SmoI	CTYRAG	2 cut(s)	372, 1576
SphI	GCATGC	1 cut(s)	780
SsiI	CCGC	4 cut(s)	92, 762, 1054, 1167
SspMI	CTAG	2 cut(s)	321, 1482
StyI	CCWWGG	3 cut(s)	886, 910, 1071
TaaI	ACNGT	1 cut(s)	1796
TaiI	ACGT	2 cut(s)	614, 1746
TaqI	TCGA	5 cut(s)	178, 1237, 1474, 1729, 1834
TfiI	GAWTC	1 cut(s)	431
Tru1I	TTAA	5 cut(s)	147, 552, 696, 851, 1305
Tru9I	TTAA	5 cut(s)	147, 552, 696, 851, 1305
TscAI	CASTG	3 cut(s)	499, 724, 778
TseFI	GTSAC	1 cut(s)	1739
TseI	GCWGC	3 cut(s)	764, 767, 1571
Tsp45I	GTSAC	1 cut(s)	1739
TspDTI	ATGAA	9 cut(s)	111, 299, 494, 548, 585, 723, 941, 971, 1202
TspGWI	ACGGA	2 cut(s)	572, 1266
TspRI	CASTG	3 cut(s)	499, 724, 778
VpaK11BI	GGWCC	8 cut(s)	497, 1037, 1046, 1154, 1169, 1208, 1265, 1800
XagI	CCTNNNNNAGG	2 cut(s)	1176, 1624
XapI	RAATTY	6 cut(s)	19, 288, 452, 481, 958, 985
XceI	RCATGY	1 cut(s)	780
XcmI	CCANNNNNNNNNTGG	1 cut(s)	616
XmnI	GAANNNNTTC	1 cut(s)	316
XspI	CTAG	2 cut(s)	321, 1482
Zsp2I	ATGCAT	1 cut(s)	177

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.