Rmu_co8125756.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8125756.1
OG0008119
Physical Location & Seq
Reverse (-)
250 .. 561
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8125756.1_g000001.1.cds

Sequence Viewer

Length: 312 bp
atgaacaacaccagtcaaagcattcagcaacctcaacctcccattggaaattctcaagttcaaagcaccgaggctatatatgggccatctccagtcaaggaacctgacttccagtccaacggataccctaatttccaggggttggaaagtgatttcgagaactggctactggacaatcagccaactccaccagtaacaaatgattatgtgccttctcaactggatctcttgtctccagggcctgttcttgctgacgcggggatgcttctgtttgattttgaaacctctctcaacagtctcacacaggtgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CSD

Protein Analysis

103

Amino Acids

11.27

Weight (kDa)

4.05

Isoelectric Point (pI)

53.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 142
AccII CGCG 1 cut(s) 257
AciI CCGC 1 cut(s) 257
AclWI GGATC 1 cut(s) 231
AcsI RAATTY 1 cut(s) 49
AfiI CCNNNNNNNGG 2 cut(s) 44, 142
AgsI TTSAA 2 cut(s) 62, 281
AhdI GACNNNNNGTC 1 cut(s) 112
AjnI CCWGG 2 cut(s) 135, 235
AleI CACNNNNGTG 1 cut(s) 305
AloI GAACNNNNNNTCC 2 cut(s) 93, 125
Alw26I GTCTC 2 cut(s) 237, 302
AlwI GGATC 1 cut(s) 231
AlwNI CAGNNNCTG 1 cut(s) 242
AoxI GGCC 2 cut(s) 83, 239
ApoI RAATTY 1 cut(s) 49
AspS9I GGNCC 2 cut(s) 83, 239
BccI CCATC 1 cut(s) 94
BciT130I CCWGG 2 cut(s) 137, 237
BciVI GTATCC 1 cut(s) 116
BcoDI GTCTC 2 cut(s) 237, 302
BfuI GTATCC 1 cut(s) 116
Bme1390I CCNGG 2 cut(s) 137, 237
BmeRI GACNNNNNGTC 1 cut(s) 112
BmgT120I GGNCC 2 cut(s) 83, 239
BmiI GGNNCC 1 cut(s) 102
BmrFI CCNGG 2 cut(s) 137, 237
BmsI GCATC 1 cut(s) 252
BpmI CTGGAG 2 cut(s) 75, 219
BpuEI CTTGAG 1 cut(s) 39
BsaJI CCNNGG 3 cut(s) 69, 136, 236
Bsc4I CCNNNNNNNGG 2 cut(s) 44, 142
Bse1I ACTGG 7 cut(s) 12, 92, 112, 167, 174, 191, 225
BseBI CCWGG 2 cut(s) 137, 237
BseDI CCNNGG 3 cut(s) 69, 136, 236
BseGI GGATG 1 cut(s) 267
BseLI CCNNNNNNNGG 2 cut(s) 44, 142
BseNI ACTGG 7 cut(s) 12, 92, 112, 167, 174, 191, 225
Bsh1236I CGCG 1 cut(s) 257
BshFI GGCC 2 cut(s) 85, 241
BslI CCNNNNNNNGG 2 cut(s) 44, 142
BsmAI GTCTC 2 cut(s) 237, 302
BsmI GAATGC 1 cut(s) 21
BsnI GGCC 2 cut(s) 85, 241
Bsp143I GATC 1 cut(s) 223
BspACI CCGC 1 cut(s) 257
BspANI GGCC 2 cut(s) 85, 241
BspFNI CGCG 1 cut(s) 257
BspLI GGNNCC 1 cut(s) 102
BspPI GGATC 1 cut(s) 231
BsrI ACTGG 7 cut(s) 12, 92, 112, 167, 174, 191, 225
BssECI CCNNGG 3 cut(s) 69, 136, 236
BssMI GATC 1 cut(s) 223
Bst2UI CCWGG 2 cut(s) 137, 237
Bst4CI ACNGT 1 cut(s) 296
BstF5I GGATG 1 cut(s) 267
BstFNI CGCG 1 cut(s) 257
BstKTI GATC 1 cut(s) 226
BstMAI GTCTC 2 cut(s) 237, 302
BstMBI GATC 1 cut(s) 223
BstNI CCWGG 2 cut(s) 137, 237
BstSCI CCNGG 2 cut(s) 135, 235
BstUI CGCG 1 cut(s) 257
BstX2I RGATCY 1 cut(s) 223
BstYI RGATCY 1 cut(s) 223
BsuI GTATCC 1 cut(s) 116
BsuRI GGCC 2 cut(s) 85, 241
BtsCI GGATG 1 cut(s) 267
CaiI CAGNNNCTG 1 cut(s) 242
Cfr13I GGNCC 2 cut(s) 83, 239
CseI GACGC 1 cut(s) 263
CviJI RGCY 5 cut(s) 74, 85, 166, 181, 241
CviKI_1 RGCY 5 cut(s) 74, 85, 166, 181, 241
DpnI GATC 1 cut(s) 225
DpnII GATC 1 cut(s) 223
DriI GACNNNNNGTC 1 cut(s) 112
Eam1105I GACNNNNNGTC 1 cut(s) 112
EcoO109I RGGNCCY 1 cut(s) 239
EcoRII CCWGG 2 cut(s) 135, 235
FaiI YATR 4 cut(s) 77, 79, 81, 207
FauI CCCGC 1 cut(s) 250
FokI GGATG 1 cut(s) 274
GsuI CTGGAG 2 cut(s) 75, 219
HaeIII GGCC 2 cut(s) 85, 241
HgaI GACGC 1 cut(s) 263
Hpy188III TCNNGA 1 cut(s) 157
HpyAV CCTTC 1 cut(s) 222
HpyCH4III ACNGT 1 cut(s) 296
Kzo9I GATC 1 cut(s) 223
LweI GCATC 1 cut(s) 252
MaeIII GTNAC 1 cut(s) 193
MalI GATC 1 cut(s) 225
MboI GATC 1 cut(s) 223
MflI RGATCY 1 cut(s) 223
MluCI AATT 2 cut(s) 49, 130
MmeI TCCRAC 2 cut(s) 123, 141
MnlI CCTC 4 cut(s) 42, 48, 64, 295
MslI CAYNNNNRTG 1 cut(s) 305
MspR9I CCNGG 2 cut(s) 137, 237
Mva1269I GAATGC 1 cut(s) 21
MvaI CCWGG 2 cut(s) 137, 237
MvnI CGCG 1 cut(s) 257
NdeII GATC 1 cut(s) 223
NlaIV GGNNCC 1 cut(s) 102
OliI CACNNNNGTG 1 cut(s) 305
PctI GAATGC 1 cut(s) 21
PflMI CCANNNNNTGG 1 cut(s) 142
Psp6I CCWGG 2 cut(s) 135, 235
PspGI CCWGG 2 cut(s) 135, 235
PspN4I GGNNCC 1 cut(s) 102
PspPI GGNCC 2 cut(s) 83, 239
PstNI CAGNNNCTG 1 cut(s) 242
PsuI RGATCY 1 cut(s) 223
RseI CAYNNNNRTG 1 cut(s) 305
Sau3AI GATC 1 cut(s) 223
Sau96I GGNCC 2 cut(s) 83, 239
ScrFI CCNGG 2 cut(s) 137, 237
SetI ASST 5 cut(s) 34, 40, 106, 287, 309
SfaNI GCATC 1 cut(s) 252
SmiMI CAYNNNNRTG 1 cut(s) 305
SmlI CTYRAG 1 cut(s) 54
SmoI CTYRAG 1 cut(s) 54
Sse9I AATT 2 cut(s) 49, 130
SsiI CCGC 1 cut(s) 257
StyD4I CCNGG 2 cut(s) 135, 235
TaaI ACNGT 1 cut(s) 296
TaqI TCGA 1 cut(s) 156
TasI AATT 2 cut(s) 49, 130
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 135
Van91I CCANNNNNTGG 1 cut(s) 142
XapI RAATTY 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.