Rmu_co8126034.1_g000001

Alpha/beta hydrolase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8126034.1
Physical Location & Seq
Forward (+)
1 .. 437
437 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8126034.1_g000001.1.cds

Sequence Viewer

Length: 267 bp
gtaagaatggcaatcaataaattcggtatcgctgctgttaggaatgcatggtatgactcgaagaaagtcactgatgaagatatcagtggttatacaaagccattgaggacgaagggttgggataaggcacttgtggagtacacggcagcaatgctcacagacacttcatctgaatcaaagccaccattggcaaagagactccgtgatatcaaatgtcctggtaacaattatgaacctatagttttcctattaagtgttgaaatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

9.91

Weight (kDa)

9.1

Isoelectric Point (pI)

32.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010989)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 20
AfaI GTAC 1 cut(s) 140
AgsI TTSAA 1 cut(s) 260
AjnI CCWGG 1 cut(s) 217
Alw26I GTCTC 1 cut(s) 190
ApeKI GCWGC 2 cut(s) 32, 146
ApoI RAATTY 1 cut(s) 20
BbvI GCAGC 2 cut(s) 19, 158
BceAI ACGGC 1 cut(s) 159
BciT130I CCWGG 1 cut(s) 219
BcoDI GTCTC 1 cut(s) 190
BfmI CTRYAG 1 cut(s) 237
BisI GCNGC 2 cut(s) 33, 147
BlsI GCNGC 2 cut(s) 34, 148
Bme1390I CCNGG 1 cut(s) 219
BmrFI CCNGG 1 cut(s) 219
Bse3DI GCAATG 1 cut(s) 156
BseBI CCWGG 1 cut(s) 219
BseMI GCAATG 1 cut(s) 156
BseXI GCAGC 2 cut(s) 19, 158
BsmAI GTCTC 1 cut(s) 190
BsmI GAATGC 1 cut(s) 49
BsrDI GCAATG 1 cut(s) 156
Bst2UI CCWGG 1 cut(s) 219
BstMAI GTCTC 1 cut(s) 190
BstNI CCWGG 1 cut(s) 219
BstSCI CCNGG 1 cut(s) 217
BstSFI CTRYAG 1 cut(s) 237
BstV1I GCAGC 2 cut(s) 19, 158
BtsIMutI CAGTG 2 cut(s) 69, 91
Csp6I GTAC 1 cut(s) 139
CviAII CATG 1 cut(s) 48
CviJI RGCY 2 cut(s) 100, 181
CviKI_1 RGCY 2 cut(s) 100, 181
CviQI GTAC 1 cut(s) 139
Eco32I GATATC 2 cut(s) 82, 208
EcoRII CCWGG 1 cut(s) 217
EcoRV GATATC 2 cut(s) 82, 208
EcoT22I ATGCAT 1 cut(s) 49
FaeI CATG 1 cut(s) 51
FaiI YATR 5 cut(s) 49, 54, 93, 231, 239
FatI CATG 1 cut(s) 47
Fnu4HI GCNGC 2 cut(s) 33, 147
Fsp4HI GCNGC 2 cut(s) 33, 147
GluI GCNGC 2 cut(s) 33, 147
Hin1II CATG 1 cut(s) 51
HinfI GANTC 3 cut(s) 56, 173, 198
Hpy166II GTNNAC 1 cut(s) 141
Hpy188I TCNGA 2 cut(s) 172, 266
Hpy8I GTNNAC 1 cut(s) 141
HpyAV CCTTC 1 cut(s) 106
HpyCH4V TGCA 1 cut(s) 47
Hsp92II CATG 1 cut(s) 51
LpnPI CCDG 2 cut(s) 204, 231
Lsp1109I GCAGC 2 cut(s) 19, 158
MaeIII GTNAC 2 cut(s) 67, 221
MboII GAAGA 2 cut(s) 73, 89
MluCI AATT 2 cut(s) 20, 226
MlyI GAGTC 2 cut(s) 50, 192
MnlI CCTC 1 cut(s) 99
Mph1103I ATGCAT 1 cut(s) 49
MseI TTAA 1 cut(s) 251
MspR9I CCNGG 1 cut(s) 219
Mva1269I GAATGC 1 cut(s) 49
MvaI CCWGG 1 cut(s) 219
NlaIII CATG 1 cut(s) 51
NmuCI GTSAC 1 cut(s) 67
NsiI ATGCAT 1 cut(s) 49
PctI GAATGC 1 cut(s) 49
PfeI GAWTC 1 cut(s) 173
PkrI GCNGC 2 cut(s) 34, 148
PleI GAGTC 2 cut(s) 50, 192
PpsI GAGTC 2 cut(s) 50, 192
Psp6I CCWGG 1 cut(s) 217
PspGI CCWGG 1 cut(s) 217
RsaI GTAC 1 cut(s) 140
RsaNI GTAC 1 cut(s) 139
SaqAI TTAA 1 cut(s) 251
SatI GCNGC 2 cut(s) 33, 147
SchI GAGTC 2 cut(s) 50, 192
ScrFI CCNGG 1 cut(s) 219
SetI ASST 1 cut(s) 238
SfcI CTRYAG 1 cut(s) 237
SgeI CNNG 7 cut(s) 60, 70, 143, 154, 215, 230, 231
Sse9I AATT 2 cut(s) 20, 226
StyD4I CCNGG 1 cut(s) 217
TaqI TCGA 1 cut(s) 59
TasI AATT 2 cut(s) 20, 226
TatI WGTACW 1 cut(s) 138
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 1 cut(s) 251
Tru9I TTAA 1 cut(s) 251
TscAI CASTG 2 cut(s) 76, 91
TseFI GTSAC 1 cut(s) 67
TseI GCWGC 2 cut(s) 32, 146
Tsp45I GTSAC 1 cut(s) 67
TspDTI ATGAA 3 cut(s) 90, 156, 246
TspGWI ACGGA 1 cut(s) 191
TspRI CASTG 2 cut(s) 76, 91
XapI RAATTY 1 cut(s) 20
Zsp2I ATGCAT 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.