Rmu_co8135098.1_g000001

Proline iminopeptidase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8135098.1
Physical Location & Seq
Reverse (-)
1 .. 616
616 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8135098.1_g000001.1.cds

Sequence Viewer

Length: 183 bp
atgatgactgcacatctccttccaaatgacgagaacatcaagaggggggaagacgatattttttcattggcatttgccaggattgaaaatcattactttgtgaacagaggattctttccttcagacgcatacctgttagataacgtcgaaaagataaggcatataaaaactacaatcgtacag
Functional Annotation

Protein Analysis

61

Amino Acids

7.17

Weight (kDa)

5.8

Isoelectric Point (pI)

47.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 105
AfaI GTAC 1 cut(s) 180
AgsI TTSAA 1 cut(s) 86
AjnI CCWGG 1 cut(s) 77
BbsI GAAGAC 1 cut(s) 57
BciT130I CCWGG 1 cut(s) 79
Bme1390I CCNGG 1 cut(s) 79
BmrFI CCNGG 1 cut(s) 79
BpiI GAAGAC 1 cut(s) 57
BseBI CCWGG 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 79
BstNI CCWGG 1 cut(s) 79
BstSCI CCNGG 1 cut(s) 77
BstV2I GAAGAC 1 cut(s) 57
CseI GACGC 1 cut(s) 134
Csp6I GTAC 1 cut(s) 179
CviQI GTAC 1 cut(s) 179
Eco57I CTGAAG 1 cut(s) 105
EcoRII CCWGG 1 cut(s) 77
FaiI YATR 3 cut(s) 130, 162, 164
HgaI GACGC 1 cut(s) 134
HinfI GANTC 1 cut(s) 111
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 40
Hpy8I GTNNAC 1 cut(s) 103
Hpy99I CGWCG 1 cut(s) 149
HpyAV CCTTC 2 cut(s) 29, 129
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 144
LpnPI CCDG 3 cut(s) 64, 91, 146
MaeII ACGT 1 cut(s) 144
MboII GAAGA 1 cut(s) 62
MnlI CCTC 2 cut(s) 36, 101
MspR9I CCNGG 1 cut(s) 79
MvaI CCWGG 1 cut(s) 79
PfeI GAWTC 1 cut(s) 111
Psp6I CCWGG 1 cut(s) 77
PspGI CCWGG 1 cut(s) 77
RsaI GTAC 1 cut(s) 180
RsaNI GTAC 1 cut(s) 179
ScrFI CCNGG 1 cut(s) 79
SetI ASST 2 cut(s) 135, 147
SgeI CNNG 5 cut(s) 43, 52, 90, 91, 145
StyD4I CCNGG 1 cut(s) 77
TaiI ACGT 1 cut(s) 147
TaqI TCGA 1 cut(s) 147
TfiI GAWTC 1 cut(s) 111
TspDTI ATGAA 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.