Rmu_co8160066.1_g000001

Belongs to the 'GDSL' lipolytic enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8160066.1
OG0008949
Physical Location & Seq
Reverse (-)
2 .. 339
338 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8160066.1_g000001.1.cds

Sequence Viewer

Length: 338 bp
atgattttgcagtctgtgataccgctatggaagcaattggactactacaaggaataccaagctaaactgagagcttaccagggaggaaatgaagcagacgaaacaatcaacgaagctttacacgtgatgagcttaggaactaatgacttcctggagaactactactccacatttccaccatcaggccgatcatcccaatacactacctcccaataccaagactttctcatcggaatcgcagcgaatttcgtgaaggaactctacaagctcggagctcggaaaatttccgtgggaggactgcctccaatggggtgcttgccattagagagaaccagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

112

Amino Acids

12.65

Weight (kDa)

5.75

Isoelectric Point (pI)

42.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 23
AcsI RAATTY 2 cut(s) 244, 282
AcvI CACGTG 1 cut(s) 124
AfiI CCNNNNNNNGG 2 cut(s) 182, 308
AflIII ACRYGT 1 cut(s) 121
AjnI CCWGG 2 cut(s) 78, 150
AloI GAACNNNNNNTCC 2 cut(s) 149, 181
AluBI AGCT 6 cut(s) 62, 74, 116, 132, 268, 275
AluI AGCT 6 cut(s) 62, 74, 116, 132, 268, 275
Alw21I GWGCWC 1 cut(s) 277
AoxI GGCC 1 cut(s) 184
ApeKI GCWGC 1 cut(s) 239
ApoI RAATTY 2 cut(s) 244, 282
BanII GRGCYC 1 cut(s) 277
BarI GAAGNNNNNNTAC 2 cut(s) 245, 277
BbrPI CACGTG 1 cut(s) 124
Bbv12I GWGCWC 1 cut(s) 277
BbvI GCAGC 1 cut(s) 251
BccI CCATC 1 cut(s) 187
BciT130I CCWGG 2 cut(s) 80, 152
BisI GCNGC 1 cut(s) 240
BlsI GCNGC 1 cut(s) 241
Bme1390I CCNGG 2 cut(s) 80, 152
BmrFI CCNGG 2 cut(s) 80, 152
BpmI CTGGAG 1 cut(s) 173
Bpu10I CCTNAGC 1 cut(s) 133
BsaAI YACGTR 1 cut(s) 124
BsaJI CCNNGG 2 cut(s) 79, 288
BsaXI ACNNNNNCTCC 4 cut(s) 149, 179, 191, 221
Bsc4I CCNNNNNNNGG 2 cut(s) 182, 308
Bse1I ACTGG 1 cut(s) 333
BseBI CCWGG 2 cut(s) 80, 152
BseDI CCNNGG 2 cut(s) 79, 288
BseGI GGATG 1 cut(s) 191
BseLI CCNNNNNNNGG 2 cut(s) 182, 308
BseMII CTCAG 1 cut(s) 59
BseNI ACTGG 1 cut(s) 333
BseXI GCAGC 1 cut(s) 251
BshFI GGCC 1 cut(s) 186
BsiHKAI GWGCWC 1 cut(s) 277
BslI CCNNNNNNNGG 2 cut(s) 182, 308
BsnI GGCC 1 cut(s) 186
Bsp1286I GDGCHC 1 cut(s) 277
Bsp143I GATC 1 cut(s) 188
BspACI CCGC 1 cut(s) 23
BspANI GGCC 1 cut(s) 186
BspCNI CTCAG 1 cut(s) 60
BsrI ACTGG 1 cut(s) 333
BssECI CCNNGG 2 cut(s) 79, 288
BssMI GATC 1 cut(s) 188
Bst2UI CCWGG 2 cut(s) 80, 152
BstBAI YACGTR 1 cut(s) 124
BstC8I GCNNGC 1 cut(s) 317
BstDEI CTNAG 2 cut(s) 68, 133
BstDSI CCRYGG 1 cut(s) 288
BstF5I GGATG 1 cut(s) 191
BstKTI GATC 1 cut(s) 191
BstMBI GATC 1 cut(s) 188
BstMWI GCNNNNNNNGC 1 cut(s) 31
BstNI CCWGG 2 cut(s) 80, 152
BstSCI CCNGG 2 cut(s) 78, 150
BstV1I GCAGC 1 cut(s) 251
BsuRI GGCC 1 cut(s) 186
BtgI CCRYGG 1 cut(s) 288
BtsCI GGATG 1 cut(s) 191
Cac8I GCNNGC 1 cut(s) 317
CviJI RGCY 7 cut(s) 62, 74, 116, 132, 186, 268, 275
CviKI_1 RGCY 7 cut(s) 62, 74, 116, 132, 186, 268, 275
DdeI CTNAG 2 cut(s) 68, 133
DpnI GATC 1 cut(s) 190
DpnII GATC 1 cut(s) 188
Ecl136II GAGCTC 1 cut(s) 275
Eco24I GRGCYC 1 cut(s) 277
Eco53kI GAGCTC 1 cut(s) 275
Eco72I CACGTG 1 cut(s) 124
EcoICRI GAGCTC 1 cut(s) 275
EcoRII CCWGG 2 cut(s) 78, 150
EcoT38I GRGCYC 1 cut(s) 277
FaiI YATR 1 cut(s) 28
Fnu4HI GCNGC 1 cut(s) 240
FokI GGATG 1 cut(s) 178
FriOI GRGCYC 1 cut(s) 277
Fsp4HI GCNGC 1 cut(s) 240
GluI GCNGC 1 cut(s) 240
GsuI CTGGAG 1 cut(s) 173
HaeIII GGCC 1 cut(s) 186
HindIII AAGCTT 1 cut(s) 114
HinfI GANTC 1 cut(s) 234
Hpy188I TCNGA 3 cut(s) 233, 272, 279
Hpy188III TCNNGA 1 cut(s) 250
HpyAV CCTTC 1 cut(s) 247
HpyCH4IV ACGT 1 cut(s) 123
HpyCH4V TGCA 1 cut(s) 10
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
HpyF3I CTNAG 2 cut(s) 68, 133
HpySE526I ACGT 1 cut(s) 123
Kzo9I GATC 1 cut(s) 188
LmnI GCTCC 1 cut(s) 272
LpnPI CCDG 5 cut(s) 65, 92, 137, 164, 168
Lsp1109I GCAGC 1 cut(s) 251
MaeII ACGT 1 cut(s) 123
MalI GATC 1 cut(s) 190
MboI GATC 1 cut(s) 188
MfeI CAATTG 1 cut(s) 35
MhlI GDGCHC 1 cut(s) 277
MluCI AATT 3 cut(s) 35, 244, 282
MnlI CCTC 4 cut(s) 77, 217, 287, 312
MspR9I CCNGG 2 cut(s) 80, 152
MunI CAATTG 1 cut(s) 35
MvaI CCWGG 2 cut(s) 80, 152
MwoI GCNNNNNNNGC 1 cut(s) 31
NdeII GATC 1 cut(s) 188
PfeI GAWTC 1 cut(s) 234
PfoI TCCNGGA 1 cut(s) 150
PkrI GCNGC 1 cut(s) 241
PmaCI CACGTG 1 cut(s) 124
PmlI CACGTG 1 cut(s) 124
Ppu21I YACGTR 1 cut(s) 124
Psp124BI GAGCTC 1 cut(s) 277
Psp6I CCWGG 2 cut(s) 78, 150
PspCI CACGTG 1 cut(s) 124
PspGI CCWGG 2 cut(s) 78, 150
SacI GAGCTC 1 cut(s) 277
SatI GCNGC 1 cut(s) 240
Sau3AI GATC 1 cut(s) 188
ScrFI CCNGG 2 cut(s) 80, 152
SduI GDGCHC 1 cut(s) 277
SetI ASST 8 cut(s) 64, 76, 118, 126, 134, 209, 270, 277
Sse9I AATT 3 cut(s) 35, 244, 282
SsiI CCGC 1 cut(s) 23
SstI GAGCTC 1 cut(s) 277
StyD4I CCNGG 2 cut(s) 78, 150
TaiI ACGT 1 cut(s) 126
TasI AATT 3 cut(s) 35, 244, 282
TfiI GAWTC 1 cut(s) 234
TseI GCWGC 1 cut(s) 239
TspDTI ATGAA 1 cut(s) 105
TspGWI ACGGA 1 cut(s) 277
XapI RAATTY 2 cut(s) 244, 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.