Rmu_co8175244.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8175244.1
Physical Location & Seq
Forward (+)
1 .. 676
676 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8175244.1_g000001.1.cds

Sequence Viewer

Length: 311 bp
cccctttatctgctaagcttatcgatgggataaatcagagtgtagcgagacgtagagccctgatgcttttttgtttgacttacaagaatgccaatgctaaggatgcatacatgctgtctgtcgaacgcaagggatttgacatattgagcaaggttgccggtccgttgttgaaggatggcattggtcagtaccagtggaaggagtttagatttacttttaaggaagaggcatgtgatgttgaatcattctgcagtcaactagtagaatggaagaggatgctgttcaggaggtttcaagccatagtggtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.84

Weight (kDa)

9.48

Isoelectric Point (pI)

47.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 190
AfiI CCNNNNNNNGG 1 cut(s) 198
AgsI TTSAA 3 cut(s) 171, 241, 295
AhlI ACTAGT 1 cut(s) 258
AluBI AGCT 1 cut(s) 18
AluI AGCT 1 cut(s) 18
Alw26I GTCTC 1 cut(s) 42
AspS9I GGNCC 1 cut(s) 160
AvaII GGWCC 1 cut(s) 160
BanII GRGCYC 1 cut(s) 60
BccI CCATC 2 cut(s) 19, 169
BcoDI GTCTC 1 cut(s) 42
BcuI ACTAGT 1 cut(s) 258
BfaI CTAG 1 cut(s) 259
BfmI CTRYAG 1 cut(s) 249
BlpI GCTNAGC 1 cut(s) 14
Bme18I GGWCC 1 cut(s) 160
BmgT120I GGNCC 1 cut(s) 160
BmsI GCATC 3 cut(s) 53, 93, 266
Bpu10I CCTNAGC 1 cut(s) 98
Bpu1102I GCTNAGC 1 cut(s) 14
Bsa29I ATCGAT 1 cut(s) 23
Bsc4I CCNNNNNNNGG 1 cut(s) 198
Bse118I RCCGGY 1 cut(s) 157
Bse1I ACTGG 1 cut(s) 192
BseCI ATCGAT 1 cut(s) 23
BseGI GGATG 3 cut(s) 108, 180, 281
BseLI CCNNNNNNNGG 1 cut(s) 198
BseNI ACTGG 1 cut(s) 192
BshVI ATCGAT 1 cut(s) 23
BsiSI CCGG 1 cut(s) 158
BslI CCNNNNNNNGG 1 cut(s) 198
BsmAI GTCTC 1 cut(s) 42
BsmBI CGTCTC 1 cut(s) 42
BsmI GAATGC 1 cut(s) 93
Bsp1286I GDGCHC 1 cut(s) 60
Bsp1720I GCTNAGC 1 cut(s) 14
BspDI ATCGAT 1 cut(s) 23
BspMAI CTGCAG 1 cut(s) 253
BsrFI RCCGGY 1 cut(s) 157
BsrI ACTGG 1 cut(s) 192
BssAI RCCGGY 1 cut(s) 157
Bst6I CTCTTC 2 cut(s) 218, 265
BstDEI CTNAG 2 cut(s) 14, 98
BstF5I GGATG 3 cut(s) 108, 180, 281
BstMAI GTCTC 1 cut(s) 42
BstMWI GCNNNNNNNGC 1 cut(s) 103
BstNSI RCATGY 2 cut(s) 114, 233
BstSFI CTRYAG 1 cut(s) 249
Bsu15I ATCGAT 1 cut(s) 23
BsuTUI ATCGAT 1 cut(s) 23
BtsCI GGATG 3 cut(s) 108, 180, 281
BtsIMutI CAGTG 1 cut(s) 199
Cfr10I RCCGGY 1 cut(s) 157
Cfr13I GGNCC 1 cut(s) 160
ClaI ATCGAT 1 cut(s) 23
CpoI CGGWCCG 1 cut(s) 160
Csp6I GTAC 1 cut(s) 189
CspI CGGWCCG 1 cut(s) 160
CviAII CATG 2 cut(s) 111, 230
CviJI RGCY 3 cut(s) 18, 58, 298
CviKI_1 RGCY 3 cut(s) 18, 58, 298
CviQI GTAC 1 cut(s) 189
DdeI CTNAG 2 cut(s) 14, 98
Eam1104I CTCTTC 2 cut(s) 218, 265
EarI CTCTTC 2 cut(s) 218, 265
Eco24I GRGCYC 1 cut(s) 60
Eco47I GGWCC 1 cut(s) 160
EcoT22I ATGCAT 1 cut(s) 108
EcoT38I GRGCYC 1 cut(s) 60
Esp3I CGTCTC 1 cut(s) 42
FaeI CATG 2 cut(s) 114, 233
FaiI YATR 5 cut(s) 108, 112, 142, 231, 301
FatI CATG 2 cut(s) 110, 229
FokI GGATG 3 cut(s) 115, 187, 288
FriOI GRGCYC 1 cut(s) 60
FspBI CTAG 1 cut(s) 259
HapII CCGG 1 cut(s) 158
Hin1II CATG 2 cut(s) 114, 233
HincII GTYRAC 1 cut(s) 256
HindII GTYRAC 1 cut(s) 256
HindIII AAGCTT 1 cut(s) 16
HinfI GANTC 1 cut(s) 241
HpaII CCGG 1 cut(s) 158
Hpy166II GTNNAC 1 cut(s) 256
Hpy188I TCNGA 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 285
Hpy8I GTNNAC 1 cut(s) 256
HpyAV CCTTC 2 cut(s) 165, 192
HpyCH4IV ACGT 1 cut(s) 51
HpyCH4V TGCA 2 cut(s) 106, 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 103
HpyF3I CTNAG 2 cut(s) 14, 98
HpySE526I ACGT 1 cut(s) 51
Hsp92II CATG 2 cut(s) 114, 233
LpnPI CCDG 4 cut(s) 73, 171, 205, 270
LweI GCATC 3 cut(s) 53, 93, 266
MaeI CTAG 1 cut(s) 259
MaeII ACGT 1 cut(s) 51
MboII GAAGA 2 cut(s) 235, 282
MhlI GDGCHC 1 cut(s) 60
MnlI CCTC 3 cut(s) 219, 266, 281
Mph1103I ATGCAT 1 cut(s) 108
MseI TTAA 1 cut(s) 218
MspI CCGG 1 cut(s) 158
Mva1269I GAATGC 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 103
NlaIII CATG 2 cut(s) 114, 233
NsiI ATGCAT 1 cut(s) 108
NspI RCATGY 2 cut(s) 114, 233
PctI GAATGC 1 cut(s) 93
PfeI GAWTC 1 cut(s) 241
PspPI GGNCC 1 cut(s) 160
PstI CTGCAG 1 cut(s) 253
RsaI GTAC 1 cut(s) 190
RsaNI GTAC 1 cut(s) 189
Rsr2I CGGWCCG 1 cut(s) 160
RsrII CGGWCCG 1 cut(s) 160
SaqAI TTAA 1 cut(s) 218
Sau96I GGNCC 1 cut(s) 160
SduI GDGCHC 1 cut(s) 60
SetI ASST 4 cut(s) 20, 54, 155, 292
SfaNI GCATC 3 cut(s) 53, 93, 266
SfcI CTRYAG 1 cut(s) 249
SinI GGWCC 1 cut(s) 160
SpeI ACTAGT 1 cut(s) 258
SspMI CTAG 1 cut(s) 259
TaiI ACGT 1 cut(s) 54
TaqI TCGA 2 cut(s) 23, 122
TfiI GAWTC 1 cut(s) 241
Tru1I TTAA 1 cut(s) 218
Tru9I TTAA 1 cut(s) 218
TscAI CASTG 1 cut(s) 199
TspGWI ACGGA 1 cut(s) 152
TspRI CASTG 1 cut(s) 199
VpaK11BI GGWCC 1 cut(s) 160
XceI RCATGY 2 cut(s) 114, 233
XspI CTAG 1 cut(s) 259
Zsp2I ATGCAT 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.