Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8200454.1

Orthogroup ID

OG0006379

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 570

Gene Structure 570 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8200454.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 570 bp

caaatttatcaagaagagcaacatgttcaacatcaaggttacatccctaaaaagatttttgtgggaggtttaccacatgatctaactgaagatgaattcagagactactttgctaagtttggtgcaattgatgatggaatcatcatatatgacaaggaaagcaacacacctaaaggattcggattcattacttttgattctgatgattctgttgtcgatgtcttgcataaacagaaacacaaacttcatgaactgaaagataagcaggtggaggtaatgagagctcttcctgaagttaagaagaactggcatggtatgtggagatggcttcaatttgacgatcttgctttcggtattgatcgttttttttgctatagttgtggaggtgcttacggttatggacacttccaagggtgtttatattggccaaatccgtatcatggggtttggaatattattagggttatccatgctaattggattggtggtgaagtagttgatcaaagtgcttggaatggttatcctgatcaaaacaaacttactcatgtaaactcaatcacaagttgctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03015 map03015

Pfam Domains

Protein Families

RRM_1

Protein Analysis

189

Amino Acids

22.0

Weight (kDa)

5.84

Isoelectric Point (pI)

35.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006379)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g02790 FvH4_1g18000
malus_domestica	MD02G1189700.v1.1
prunus_persica	Prupe.6G216700_v2.0.a1
pyrus_communis	pycom02g15380
rosa_chinensis	RchiOBHm_Chr2g0087881 RchiOBHm_Chr2g0108481
rosa_laevigata	RLG00000015909 RLG00000017672
rosa_multiflora	Rmu_co8200454.1_g000001 Rmu_sc0002372.1_g000049 Rmu_sc0008385.1_g000021 Rmu_sc0014136.1_g000014
rosa_roxburghii	Rroxscaffold_2G00135100
rosa_rugosa	Rorug01G0479100 Rorug02G0153700 Rorug02G0155900
rosa_samantha	Rh2AG033900 Rh2AG202400 Rh2BG033100 Rh2BG215400 Rh2CG033800 Rh2CG206600 Rh2DG033500 Rh2DG209700
rosa_wichuraiana	Rw2G002660 Rw2G016180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	256
Acc36I	ACCTGC	1 cut(s)	256
AcoI	YGGCCR	1 cut(s)	425
AcsI	RAATTY	2 cut(s)	3, 95
AcuI	CTGAAG	2 cut(s)	108, 312
AfiI	CCNNNNNNNGG	1 cut(s)	440
AflIII	ACRYGT	1 cut(s)	22
AgsI	TTSAA	2 cut(s)	29, 332
AluBI	AGCT	1 cut(s)	284
AluI	AGCT	1 cut(s)	284
Alw21I	GWGCWC	1 cut(s)	286
Alw26I	GTCTC	1 cut(s)	96
AoxI	GGCC	1 cut(s)	425
ApoI	RAATTY	2 cut(s)	3, 95
AsuHPI	GGTGA	1 cut(s)	500
BalI	TGGCCA	1 cut(s)	427
BanII	GRGCYC	1 cut(s)	286
Bbv12I	GWGCWC	1 cut(s)	286
BccI	CCATC	2 cut(s)	128, 318
BclI	TGATCA	2 cut(s)	499, 526
BcoDI	GTCTC	1 cut(s)	96
BfmI	CTRYAG	1 cut(s)	373
BfuAI	ACCTGC	1 cut(s)	256
BsaJI	CCNNGG	1 cut(s)	409
Bsc4I	CCNNNNNNNGG	1 cut(s)	440
Bse1I	ACTGG	1 cut(s)	311
BseDI	CCNNGG	1 cut(s)	409
BseGI	GGATG	1 cut(s)	42
BseLI	CCNNNNNNNGG	1 cut(s)	440
BseNI	ACTGG	1 cut(s)	311
BshFI	GGCC	1 cut(s)	427
BsiHKAI	GWGCWC	1 cut(s)	286
BslI	CCNNNNNNNGG	1 cut(s)	440
BsmAI	GTCTC	1 cut(s)	96
BsnI	GGCC	1 cut(s)	427
Bsp1286I	GDGCHC	1 cut(s)	286
Bsp143I	GATC	5 cut(s)	79, 340, 358, 499, 526
BspANI	GGCC	1 cut(s)	427
BspHI	TCATGA	1 cut(s)	247
BspMI	ACCTGC	1 cut(s)	256
BspQI	GCTCTTC	2 cut(s)	9, 291
BsrI	ACTGG	1 cut(s)	311
BssECI	CCNNGG	1 cut(s)	409
BssMI	GATC	5 cut(s)	79, 340, 358, 499, 526
BssT1I	CCWWGG	1 cut(s)	409
Bst4CI	ACNGT	1 cut(s)	395
Bst6I	CTCTTC	2 cut(s)	9, 291
BstDEI	CTNAG	1 cut(s)	114
BstF5I	GGATG	1 cut(s)	42
BstKTI	GATC	5 cut(s)	82, 343, 361, 502, 529
BstMAI	GTCTC	1 cut(s)	96
BstMBI	GATC	5 cut(s)	79, 340, 358, 499, 526
BstNSI	RCATGY	1 cut(s)	26
BstSFI	CTRYAG	1 cut(s)	373
BsuRI	GGCC	1 cut(s)	427
BtsCI	GGATG	1 cut(s)	42
BveI	ACCTGC	1 cut(s)	256
CciI	TCATGA	1 cut(s)	247
CviAII	CATG	7 cut(s)	23, 77, 248, 311, 440, 470, 545
CviJI	RGCY	3 cut(s)	284, 328, 427
CviKI_1	RGCY	3 cut(s)	284, 328, 427
DdeI	CTNAG	1 cut(s)	114
DpnI	GATC	5 cut(s)	81, 342, 360, 501, 528
DpnII	GATC	5 cut(s)	79, 340, 358, 499, 526
EaeI	YGGCCR	1 cut(s)	425
Eam1104I	CTCTTC	2 cut(s)	9, 291
EarI	CTCTTC	2 cut(s)	9, 291
Ecl136II	GAGCTC	1 cut(s)	284
Eco130I	CCWWGG	1 cut(s)	409
Eco24I	GRGCYC	1 cut(s)	286
Eco53kI	GAGCTC	1 cut(s)	284
Eco57I	CTGAAG	2 cut(s)	108, 312
EcoICRI	GAGCTC	1 cut(s)	284
EcoRI	GAATTC	1 cut(s)	95
EcoT14I	CCWWGG	1 cut(s)	409
EcoT38I	GRGCYC	1 cut(s)	286
ErhI	CCWWGG	1 cut(s)	409
FaeI	CATG	7 cut(s)	26, 80, 251, 314, 443, 473, 548
FatI	CATG	7 cut(s)	22, 76, 247, 310, 439, 469, 544
FbaI	TGATCA	2 cut(s)	499, 526
FokI	GGATG	1 cut(s)	29
FriOI	GRGCYC	1 cut(s)	286
HaeIII	GGCC	1 cut(s)	427
Hin1II	CATG	7 cut(s)	26, 80, 251, 314, 443, 473, 548
HinfI	GANTC	5 cut(s)	138, 177, 183, 197, 206
HphI	GGTGA	1 cut(s)	500
Hpy166II	GTNNAC	2 cut(s)	71, 550
Hpy188I	TCNGA	3 cut(s)	101, 182, 202
Hpy188III	TCNNGA	4 cut(s)	11, 248, 290, 524
Hpy8I	GTNNAC	2 cut(s)	71, 550
HpyCH4III	ACNGT	1 cut(s)	395
HpyCH4V	TGCA	2 cut(s)	125, 226
HpyF3I	CTNAG	1 cut(s)	114
Hsp92II	CATG	7 cut(s)	26, 80, 251, 314, 443, 473, 548
Ksp22I	TGATCA	2 cut(s)	499, 526
Kzo9I	GATC	5 cut(s)	79, 340, 358, 499, 526
LguI	GCTCTTC	2 cut(s)	9, 291
LpnPI	CCDG	4 cut(s)	251, 292, 303, 537
MaeIII	GTNAC	1 cut(s)	38
MalI	GATC	5 cut(s)	81, 342, 360, 501, 528
MboI	GATC	5 cut(s)	79, 340, 358, 499, 526
MboII	GAAGA	4 cut(s)	26, 101, 278, 313
MfeI	CAATTG	1 cut(s)	126
MhlI	GDGCHC	1 cut(s)	286
MlsI	TGGCCA	1 cut(s)	427
MluCI	AATT	5 cut(s)	3, 95, 126, 332, 475
MluNI	TGGCCA	1 cut(s)	427
MnlI	CCTC	3 cut(s)	59, 265, 377
Mox20I	TGGCCA	1 cut(s)	427
MscI	TGGCCA	1 cut(s)	427
MseI	TTAA	1 cut(s)	297
Msp20I	TGGCCA	1 cut(s)	427
MunI	CAATTG	1 cut(s)	126
NdeII	GATC	5 cut(s)	79, 340, 358, 499, 526
NlaIII	CATG	7 cut(s)	26, 80, 251, 314, 443, 473, 548
NspI	RCATGY	1 cut(s)	26
PagI	TCATGA	1 cut(s)	247
PaqCI	CACCTGC	1 cut(s)	256
PciI	ACATGT	1 cut(s)	22
PciSI	GCTCTTC	2 cut(s)	9, 291
PfeI	GAWTC	5 cut(s)	138, 177, 183, 197, 206
PscI	ACATGT	1 cut(s)	22
Psp124BI	GAGCTC	1 cut(s)	286
SacI	GAGCTC	1 cut(s)	286
SapI	GCTCTTC	2 cut(s)	9, 291
SaqAI	TTAA	1 cut(s)	297
Sau3AI	GATC	5 cut(s)	79, 340, 358, 499, 526
SduI	GDGCHC	1 cut(s)	286
SetI	ASST	7 cut(s)	40, 70, 172, 270, 276, 286, 388
SfcI	CTRYAG	1 cut(s)	373
Sse9I	AATT	5 cut(s)	3, 95, 126, 332, 475
SspI	AATATT	1 cut(s)	454
SstI	GAGCTC	1 cut(s)	286
StyI	CCWWGG	1 cut(s)	409
TaaI	ACNGT	1 cut(s)	395
TaqI	TCGA	1 cut(s)	216
TasI	AATT	5 cut(s)	3, 95, 126, 332, 475
TfiI	GAWTC	5 cut(s)	138, 177, 183, 197, 206
Tru1I	TTAA	1 cut(s)	297
Tru9I	TTAA	1 cut(s)	297
TspDTI	ATGAA	4 cut(s)	108, 175, 236, 264
TspGWI	ACGGA	1 cut(s)	423
XapI	RAATTY	2 cut(s)	3, 95
XceI	RCATGY	1 cut(s)	26

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.