Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002372.1

Orthogroup ID

OG0006379

Physical Location & Seq

Genomic Coordinates Forward (+)

214778 .. 215728

Gene Structure 951 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002372.1_g000049.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 834 bp

atggaaggagagcaagagagaaagttgtttgtgggtggaataccatggcaggttgacaaaactattttggaagaacacttcagccaatatggtgaagtagaagaatgcgtgatcgtgctagatagaatcactcgtcaacctagagggtttggttttgttaccttcaccgaccaattggtggctgagaaagtcttggaagaaaaccactccatctttgacaaaaagcttgttgtaaatccctcagaaccaaggcgcggaacgaaccagaataaccaaagcgatcaacatgctcagcgtcgaggatcttatcaccccaaaaagatatttgtggggggtttaccgcatcatcttacagaagaagaatttatcaactactttgcgaagtttggcgcaattgatgagggggtgattatgtatgaaaaggaaaccaacacgtcgaggggatttggtttcatcacttttgaatcagatgagactgttaaagatgtaatgcagaaaagttttcacgaactgaaaaatgagatagtggaggtccggcaggctcgtctcgaagtaaggaggaatcacagacgtttggtgaactggtatgaccctgagaatgtagggtcggaacttgtaggaggccttcgatacgatgatcttgcttttggggttgatcgtcttttctgctacaattgtggaggtccttatggttatggacattatccagggtgcttgtatggggaggatccttatagggggacttggaatactgtgaaggttctccataccaattgggttggtggtggtgaagtggatccgtgggcgtggaatggttatctacaattaatataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03015 map03015

Pfam Domains

Protein Families

RRM_1

Protein Analysis

277

Amino Acids

32.05

Weight (kDa)

5.43

Isoelectric Point (pI)

29.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006379)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g02790 FvH4_1g18000
malus_domestica	MD02G1189700.v1.1
prunus_persica	Prupe.6G216700_v2.0.a1
pyrus_communis	pycom02g15380
rosa_chinensis	RchiOBHm_Chr2g0087881 RchiOBHm_Chr2g0108481
rosa_laevigata	RLG00000015909 RLG00000017672
rosa_multiflora	Rmu_co8200454.1_g000001 Rmu_sc0002372.1_g000049 Rmu_sc0008385.1_g000021 Rmu_sc0014136.1_g000014
rosa_roxburghii	Rroxscaffold_2G00135100
rosa_rugosa	Rorug01G0479100 Rorug02G0153700 Rorug02G0155900
rosa_samantha	Rh2AG033900 Rh2AG202400 Rh2BG033100 Rh2BG215400 Rh2CG033800 Rh2CG206600 Rh2DG033500 Rh2DG209700
rosa_wichuraiana	Rw2G002660 Rw2G016180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	40
AccB7I	CCANNNNNTGG	1 cut(s)	178
AccII	CGCG	1 cut(s)	255
AciI	CCGC	2 cut(s)	255, 341
AclWI	GGATC	5 cut(s)	310, 722, 735, 791, 804
AcsI	RAATTY	1 cut(s)	362
AcuI	CTGAAG	1 cut(s)	64
AfiI	CCNNNNNNNGG	3 cut(s)	178, 254, 737
AflIII	ACRYGT	1 cut(s)	432
AgsI	TTSAA	1 cut(s)	464
AjiI	CACGTC	1 cut(s)	435
AjnI	CCWGG	1 cut(s)	706
AluBI	AGCT	1 cut(s)	226
AluI	AGCT	1 cut(s)	226
Alw26I	GTCTC	2 cut(s)	467, 551
AlwI	GGATC	5 cut(s)	310, 722, 735, 791, 804
AoxI	GGCC	1 cut(s)	622
ApoI	RAATTY	1 cut(s)	362
AseI	ATTAAT	1 cut(s)	827
AspLEI	GCGC	2 cut(s)	255, 392
AspS9I	GGNCC	2 cut(s)	532, 683
AsuHPI	GGTGA	6 cut(s)	104, 157, 302, 418, 589, 800
AvaII	GGWCC	2 cut(s)	532, 683
BamHI	GGATCC	2 cut(s)	727, 796
BarI	GAAGNNNNNNTAC	2 cut(s)	609, 641
BccI	CCATC	1 cut(s)	218
BcgI	CGANNNNNNTGC	4 cut(s)	269, 303, 623, 657
BciT130I	CCWGG	1 cut(s)	708
BcoDI	GTCTC	2 cut(s)	467, 551
BfaI	CTAG	2 cut(s)	119, 141
BfuAI	ACCTGC	1 cut(s)	40
BlpI	GCTNAGC	1 cut(s)	291
Bme1390I	CCNGG	1 cut(s)	708
Bme18I	GGWCC	2 cut(s)	532, 683
BmgBI	CACGTC	1 cut(s)	435
BmgT120I	GGNCC	2 cut(s)	532, 683
BmiI	GGNNCC	2 cut(s)	729, 798
BmrFI	CCNGG	1 cut(s)	708
BmsI	GCATC	1 cut(s)	352
Bpu1102I	GCTNAGC	1 cut(s)	291
BsaJI	CCNNGG	4 cut(s)	44, 248, 707, 800
Bsc4I	CCNNNNNNNGG	3 cut(s)	178, 254, 737
Bse1I	ACTGG	1 cut(s)	587
BseBI	CCWGG	1 cut(s)	708
BseDI	CCNNGG	4 cut(s)	44, 248, 707, 800
BseLI	CCNNNNNNNGG	3 cut(s)	178, 254, 737
BseMII	CTCAG	4 cut(s)	174, 255, 305, 585
BseNI	ACTGG	1 cut(s)	587
Bsh1236I	CGCG	1 cut(s)	255
BshFI	GGCC	1 cut(s)	624
BsiSI	CCGG	1 cut(s)	535
BslFI	GGGAC	1 cut(s)	754
BslI	CCNNNNNNNGG	3 cut(s)	178, 254, 737
BsmAI	GTCTC	2 cut(s)	467, 551
BsmBI	CGTCTC	1 cut(s)	551
BsmFI	GGGAC	1 cut(s)	754
BsmI	GAATGC	1 cut(s)	110
BsnI	GGCC	1 cut(s)	624
Bsp143I	GATC	7 cut(s)	111, 280, 302, 637, 655, 727, 796
Bsp1720I	GCTNAGC	1 cut(s)	291
Bsp19I	CCATGG	1 cut(s)	44
BspACI	CCGC	2 cut(s)	255, 341
BspANI	GGCC	1 cut(s)	624
BspCNI	CTCAG	4 cut(s)	175, 254, 304, 586
BspFNI	CGCG	1 cut(s)	255
BspLI	GGNNCC	2 cut(s)	729, 798
BspMI	ACCTGC	1 cut(s)	40
BspPI	GGATC	5 cut(s)	310, 722, 735, 791, 804
BsrI	ACTGG	1 cut(s)	587
BssECI	CCNNGG	4 cut(s)	44, 248, 707, 800
BssMI	GATC	7 cut(s)	111, 280, 302, 637, 655, 727, 796
BssT1I	CCWWGG	2 cut(s)	44, 248
Bst2UI	CCWGG	1 cut(s)	708
Bst4CI	ACNGT	2 cut(s)	478, 754
BstC8I	GCNNGC	1 cut(s)	540
BstDEI	CTNAG	4 cut(s)	183, 241, 291, 594
BstDSI	CCRYGG	2 cut(s)	44, 800
BstFNI	CGCG	1 cut(s)	255
BstHHI	GCGC	2 cut(s)	255, 392
BstKTI	GATC	7 cut(s)	114, 283, 305, 640, 658, 730, 799
BstMAI	GTCTC	2 cut(s)	467, 551
BstMBI	GATC	7 cut(s)	111, 280, 302, 637, 655, 727, 796
BstNI	CCWGG	1 cut(s)	708
BstNSI	RCATGY	1 cut(s)	290
BstSCI	CCNGG	1 cut(s)	706
BstUI	CGCG	1 cut(s)	255
BstX2I	RGATCY	3 cut(s)	302, 727, 796
BstYI	RGATCY	3 cut(s)	302, 727, 796
BsuRI	GGCC	1 cut(s)	624
BtgI	CCRYGG	2 cut(s)	44, 800
BtrI	CACGTC	1 cut(s)	435
BveI	ACCTGC	1 cut(s)	40
Cac8I	GCNNGC	1 cut(s)	540
CfoI	GCGC	2 cut(s)	255, 392
Cfr13I	GGNCC	2 cut(s)	532, 683
CseI	GACGC	1 cut(s)	284
CviAII	CATG	2 cut(s)	45, 287
CviJI	RGCY	5 cut(s)	84, 182, 226, 542, 624
CviKI_1	RGCY	5 cut(s)	84, 182, 226, 542, 624
DdeI	CTNAG	4 cut(s)	183, 241, 291, 594
DpnI	GATC	7 cut(s)	113, 282, 304, 639, 657, 729, 798
DpnII	GATC	7 cut(s)	111, 280, 302, 637, 655, 727, 796
Eco130I	CCWWGG	2 cut(s)	44, 248
Eco147I	AGGCCT	1 cut(s)	624
Eco47I	GGWCC	2 cut(s)	532, 683
Eco57I	CTGAAG	1 cut(s)	64
EcoO109I	RGGNCCY	1 cut(s)	683
EcoRII	CCWGG	1 cut(s)	706
EcoT14I	CCWWGG	2 cut(s)	44, 248
ErhI	CCWWGG	2 cut(s)	44, 248
Esp3I	CGTCTC	1 cut(s)	551
FaeI	CATG	2 cut(s)	48, 290
FaqI	GGGAC	1 cut(s)	754
FatI	CATG	2 cut(s)	44, 286
FspBI	CTAG	2 cut(s)	119, 141
GlaI	GCGC	2 cut(s)	254, 391
HaeIII	GGCC	1 cut(s)	624
HapII	CCGG	1 cut(s)	535
HgaI	GACGC	1 cut(s)	284
HhaI	GCGC	2 cut(s)	255, 392
Hin1II	CATG	2 cut(s)	48, 290
Hin6I	GCGC	2 cut(s)	253, 390
HinP1I	GCGC	2 cut(s)	253, 390
HincII	GTYRAC	2 cut(s)	55, 137
HindII	GTYRAC	2 cut(s)	55, 137
HindIII	AAGCTT	1 cut(s)	224
HinfI	GANTC	3 cut(s)	126, 464, 562
HpaII	CCGG	1 cut(s)	535
HphI	GGTGA	6 cut(s)	104, 157, 302, 418, 589, 800
Hpy166II	GTNNAC	4 cut(s)	55, 137, 338, 580
Hpy188I	TCNGA	3 cut(s)	244, 469, 610
Hpy188III	TCNNGA	2 cut(s)	506, 548
Hpy8I	GTNNAC	4 cut(s)	55, 137, 338, 580
Hpy99I	CGWCG	2 cut(s)	300, 439
HpyAV	CCTTC	3 cut(s)	172, 635, 751
HpyCH4III	ACNGT	2 cut(s)	478, 754
HpyCH4IV	ACGT	2 cut(s)	434, 571
HpyCH4V	TGCA	1 cut(s)	493
HpyF3I	CTNAG	4 cut(s)	183, 241, 291, 594
HpySE526I	ACGT	2 cut(s)	434, 571
Hsp92II	CATG	2 cut(s)	48, 290
HspAI	GCGC	2 cut(s)	253, 390
Kzo9I	GATC	7 cut(s)	111, 280, 302, 637, 655, 727, 796
LpnPI	CCDG	8 cut(s)	35, 278, 524, 548, 568, 606, 693, 720
LweI	GCATC	1 cut(s)	352
MaeI	CTAG	2 cut(s)	119, 141
MaeII	ACGT	2 cut(s)	434, 571
MaeIII	GTNAC	1 cut(s)	157
MalI	GATC	7 cut(s)	113, 282, 304, 639, 657, 729, 798
MboI	GATC	7 cut(s)	111, 280, 302, 637, 655, 727, 796
MboII	GAAGA	5 cut(s)	83, 113, 209, 368, 371
MfeI	CAATTG	4 cut(s)	173, 393, 673, 772
MflI	RGATCY	3 cut(s)	302, 727, 796
MluCI	AATT	6 cut(s)	173, 362, 393, 673, 772, 824
MmeI	TCCRAC	1 cut(s)	588
MseI	TTAA	2 cut(s)	480, 827
MspI	CCGG	1 cut(s)	535
MspR9I	CCNGG	1 cut(s)	708
MunI	CAATTG	4 cut(s)	173, 393, 673, 772
Mva1269I	GAATGC	1 cut(s)	110
MvaI	CCWGG	1 cut(s)	708
MvnI	CGCG	1 cut(s)	255
NcoI	CCATGG	1 cut(s)	44
NdeII	GATC	7 cut(s)	111, 280, 302, 637, 655, 727, 796
NlaIII	CATG	2 cut(s)	48, 290
NlaIV	GGNNCC	2 cut(s)	729, 798
NspI	RCATGY	1 cut(s)	290
PceI	AGGCCT	1 cut(s)	624
PctI	GAATGC	1 cut(s)	110
PfeI	GAWTC	3 cut(s)	126, 464, 562
PflMI	CCANNNNNTGG	1 cut(s)	178
PpuMI	RGGWCCY	1 cut(s)	683
PshBI	ATTAAT	1 cut(s)	827
Psp5II	RGGWCCY	1 cut(s)	683
Psp6I	CCWGG	1 cut(s)	706
PspGI	CCWGG	1 cut(s)	706
PspN4I	GGNNCC	2 cut(s)	729, 798
PspPI	GGNCC	2 cut(s)	532, 683
PspPPI	RGGWCCY	1 cut(s)	683
PsuI	RGATCY	3 cut(s)	302, 727, 796
SaqAI	TTAA	2 cut(s)	480, 827
Sau3AI	GATC	7 cut(s)	111, 280, 302, 637, 655, 727, 796
Sau96I	GGNCC	2 cut(s)	532, 683
ScrFI	CCNGG	1 cut(s)	708
SetI	ASST	9 cut(s)	54, 142, 164, 228, 437, 534, 574, 685, 762
SfaNI	GCATC	1 cut(s)	352
SinI	GGWCC	2 cut(s)	532, 683
Sse9I	AATT	6 cut(s)	173, 362, 393, 673, 772, 824
SseBI	AGGCCT	1 cut(s)	624
SsiI	CCGC	2 cut(s)	255, 341
SspMI	CTAG	2 cut(s)	119, 141
StuI	AGGCCT	1 cut(s)	624
StyD4I	CCNGG	1 cut(s)	706
StyI	CCWWGG	2 cut(s)	44, 248
TaaI	ACNGT	2 cut(s)	478, 754
TaiI	ACGT	2 cut(s)	437, 574
TaqI	TCGA	4 cut(s)	298, 437, 549, 628
TasI	AATT	6 cut(s)	173, 362, 393, 673, 772, 824
TfiI	GAWTC	3 cut(s)	126, 464, 562
Tru1I	TTAA	2 cut(s)	480, 827
Tru9I	TTAA	2 cut(s)	480, 827
TspDTI	ATGAA	2 cut(s)	432, 442
TspGWI	ACGGA	1 cut(s)	789
Van91I	CCANNNNNTGG	1 cut(s)	178
VpaK11BI	GGWCC	2 cut(s)	532, 683
VspI	ATTAAT	1 cut(s)	827
XapI	RAATTY	1 cut(s)	362
XceI	RCATGY	1 cut(s)	290
XspI	CTAG	2 cut(s)	119, 141

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.