Rmu_sc0008385.1_g000021

RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008385.1
Physical Location & Seq
Reverse (-)
78538 .. 79640
1103 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008385.1_g000021.1.cds

Sequence Viewer

Length: 837 bp
atggacgcaaagcaagacagaaagatatttgtgggtggaataacaggggaggttgatgaagatatcttggaagaacacttcagtagatatggcgtggtagaagagtgtgtgatcgttttggataaaatcactcgtcaacctagagagtttggttttgttaccttcactgacccgttagtggctaagagagtattggaagaagaaaaccactccatctttggcaagaagattgatgtaaggccttcggaaccaaagcgtgagagaaaccaaatttatcaagaagagcaacatgttcaacatcaaggttacatccctaaaaagatttttgtgggaggtttaccacatgatctaactgaagatgaattcagagactactttgctaagtttggtgcaattgatgatggaatcatcatatatgacaaggaaagcaacacacctaaaggattcggattcattacttttgattctgatgattctgttgtcgatgtcttgcataaacagaaacacaaacttcatgaactgaaagataagcaggtggaggtaatgagagctcttcctgaagttaagaagaactggcatggtatgtggagatggcttcaatttgacgatcttgctttcggtattgatcgttttttttgctatagttgtggaggtgcttacggttatggacacttccaagggtgtttatattggccaaatccgtatcatggggtttggaatattattagggttatccatgctaattggattggtggtgaagtagttgatcaaagtgcttggaatggttatcctgatcaaaacaaacttactcatgtaaactcaatcacaagttgctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

278

Amino Acids

32.32

Weight (kDa)

5.62

Isoelectric Point (pI)

38.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 523
Acc36I ACCTGC 1 cut(s) 523
AcoI YGGCCR 1 cut(s) 692
AcsI RAATTY 2 cut(s) 270, 362
AcuI CTGAAG 3 cut(s) 64, 375, 579
AfiI CCNNNNNNNGG 2 cut(s) 178, 707
AflIII ACRYGT 1 cut(s) 289
AgsI TTSAA 2 cut(s) 296, 599
AluBI AGCT 1 cut(s) 551
AluI AGCT 1 cut(s) 551
Alw21I GWGCWC 1 cut(s) 553
Alw26I GTCTC 1 cut(s) 363
AoxI GGCC 2 cut(s) 239, 692
ApoI RAATTY 2 cut(s) 270, 362
AsuHPI GGTGA 1 cut(s) 767
BalI TGGCCA 1 cut(s) 694
BanII GRGCYC 1 cut(s) 553
Bbv12I GWGCWC 1 cut(s) 553
BccI CCATC 3 cut(s) 221, 395, 585
BclI TGATCA 2 cut(s) 766, 793
BcoDI GTCTC 1 cut(s) 363
BfaI CTAG 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 640
BfuAI ACCTGC 1 cut(s) 523
BmiI GGNNCC 1 cut(s) 249
BsaJI CCNNGG 1 cut(s) 676
Bsc4I CCNNNNNNNGG 2 cut(s) 178, 707
Bse1I ACTGG 1 cut(s) 578
BseDI CCNNGG 1 cut(s) 676
BseGI GGATG 1 cut(s) 309
BseLI CCNNNNNNNGG 2 cut(s) 178, 707
BseNI ACTGG 1 cut(s) 578
BshFI GGCC 2 cut(s) 241, 694
BsiHKAI GWGCWC 1 cut(s) 553
BslI CCNNNNNNNGG 2 cut(s) 178, 707
BsmAI GTCTC 1 cut(s) 363
BsnI GGCC 2 cut(s) 241, 694
Bsp1286I GDGCHC 1 cut(s) 553
Bsp143I GATC 6 cut(s) 111, 346, 607, 625, 766, 793
BspANI GGCC 2 cut(s) 241, 694
BspHI TCATGA 1 cut(s) 514
BspLI GGNNCC 1 cut(s) 249
BspMI ACCTGC 1 cut(s) 523
BspQI GCTCTTC 2 cut(s) 276, 558
BsrI ACTGG 1 cut(s) 578
BssECI CCNNGG 1 cut(s) 676
BssMI GATC 6 cut(s) 111, 346, 607, 625, 766, 793
BssT1I CCWWGG 1 cut(s) 676
Bst4CI ACNGT 1 cut(s) 662
Bst6I CTCTTC 3 cut(s) 96, 276, 558
BstDEI CTNAG 2 cut(s) 183, 381
BstF5I GGATG 1 cut(s) 309
BstKTI GATC 6 cut(s) 114, 349, 610, 628, 769, 796
BstMAI GTCTC 1 cut(s) 363
BstMBI GATC 6 cut(s) 111, 346, 607, 625, 766, 793
BstNSI RCATGY 1 cut(s) 293
BstSFI CTRYAG 1 cut(s) 640
BsuRI GGCC 2 cut(s) 241, 694
BtsCI GGATG 1 cut(s) 309
BtsIMutI CAGTG 1 cut(s) 165
BveI ACCTGC 1 cut(s) 523
CciI TCATGA 1 cut(s) 514
CseI GACGC 1 cut(s) 14
CviAII CATG 7 cut(s) 290, 344, 515, 578, 707, 737, 812
CviJI RGCY 5 cut(s) 182, 241, 551, 595, 694
CviKI_1 RGCY 5 cut(s) 182, 241, 551, 595, 694
DdeI CTNAG 2 cut(s) 183, 381
DpnI GATC 6 cut(s) 113, 348, 609, 627, 768, 795
DpnII GATC 6 cut(s) 111, 346, 607, 625, 766, 793
EaeI YGGCCR 1 cut(s) 692
Eam1104I CTCTTC 3 cut(s) 96, 276, 558
EarI CTCTTC 3 cut(s) 96, 276, 558
Ecl136II GAGCTC 1 cut(s) 551
Eco130I CCWWGG 1 cut(s) 676
Eco147I AGGCCT 1 cut(s) 241
Eco24I GRGCYC 1 cut(s) 553
Eco32I GATATC 1 cut(s) 64
Eco53kI GAGCTC 1 cut(s) 551
Eco57I CTGAAG 3 cut(s) 64, 375, 579
EcoICRI GAGCTC 1 cut(s) 551
EcoRI GAATTC 1 cut(s) 362
EcoRV GATATC 1 cut(s) 64
EcoT14I CCWWGG 1 cut(s) 676
EcoT38I GRGCYC 1 cut(s) 553
ErhI CCWWGG 1 cut(s) 676
FaeI CATG 7 cut(s) 293, 347, 518, 581, 710, 740, 815
FatI CATG 7 cut(s) 289, 343, 514, 577, 706, 736, 811
FbaI TGATCA 2 cut(s) 766, 793
FokI GGATG 1 cut(s) 296
FriOI GRGCYC 1 cut(s) 553
FspBI CTAG 1 cut(s) 141
HaeIII GGCC 2 cut(s) 241, 694
HgaI GACGC 1 cut(s) 14
Hin1II CATG 7 cut(s) 293, 347, 518, 581, 710, 740, 815
HincII GTYRAC 1 cut(s) 137
HindII GTYRAC 1 cut(s) 137
HinfI GANTC 5 cut(s) 405, 444, 450, 464, 473
HphI GGTGA 1 cut(s) 767
Hpy166II GTNNAC 3 cut(s) 137, 338, 817
Hpy188I TCNGA 4 cut(s) 247, 368, 449, 469
Hpy188III TCNNGA 4 cut(s) 278, 515, 557, 791
Hpy8I GTNNAC 3 cut(s) 137, 338, 817
HpyAV CCTTC 2 cut(s) 172, 252
HpyCH4III ACNGT 1 cut(s) 662
HpyCH4V TGCA 2 cut(s) 392, 493
HpyF3I CTNAG 2 cut(s) 183, 381
Hsp92II CATG 7 cut(s) 293, 347, 518, 581, 710, 740, 815
Ksp22I TGATCA 2 cut(s) 766, 793
Kzo9I GATC 6 cut(s) 111, 346, 607, 625, 766, 793
LguI GCTCTTC 2 cut(s) 276, 558
LpnPI CCDG 5 cut(s) 30, 518, 559, 570, 804
MaeI CTAG 1 cut(s) 141
MaeIII GTNAC 2 cut(s) 157, 305
MalI GATC 6 cut(s) 113, 348, 609, 627, 768, 795
MboI GATC 6 cut(s) 111, 346, 607, 625, 766, 793
MfeI CAATTG 1 cut(s) 393
MhlI GDGCHC 1 cut(s) 553
MlsI TGGCCA 1 cut(s) 694
MluCI AATT 5 cut(s) 270, 362, 393, 599, 742
MluNI TGGCCA 1 cut(s) 694
MnlI CCTC 4 cut(s) 43, 326, 532, 644
Mox20I TGGCCA 1 cut(s) 694
MscI TGGCCA 1 cut(s) 694
MseI TTAA 1 cut(s) 564
Msp20I TGGCCA 1 cut(s) 694
MunI CAATTG 1 cut(s) 393
NdeII GATC 6 cut(s) 111, 346, 607, 625, 766, 793
NlaIII CATG 7 cut(s) 293, 347, 518, 581, 710, 740, 815
NlaIV GGNNCC 1 cut(s) 249
NspI RCATGY 1 cut(s) 293
PagI TCATGA 1 cut(s) 514
PaqCI CACCTGC 1 cut(s) 523
PceI AGGCCT 1 cut(s) 241
PciI ACATGT 1 cut(s) 289
PciSI GCTCTTC 2 cut(s) 276, 558
PfeI GAWTC 5 cut(s) 405, 444, 450, 464, 473
PscI ACATGT 1 cut(s) 289
Psp124BI GAGCTC 1 cut(s) 553
PspN4I GGNNCC 1 cut(s) 249
SacI GAGCTC 1 cut(s) 553
SapI GCTCTTC 2 cut(s) 276, 558
SaqAI TTAA 1 cut(s) 564
Sau3AI GATC 6 cut(s) 111, 346, 607, 625, 766, 793
SduI GDGCHC 1 cut(s) 553
SfcI CTRYAG 1 cut(s) 640
Sse9I AATT 5 cut(s) 270, 362, 393, 599, 742
SseBI AGGCCT 1 cut(s) 241
SspI AATATT 1 cut(s) 721
SspMI CTAG 1 cut(s) 141
SstI GAGCTC 1 cut(s) 553
StuI AGGCCT 1 cut(s) 241
StyI CCWWGG 1 cut(s) 676
TaaI ACNGT 1 cut(s) 662
TaqI TCGA 1 cut(s) 483
TasI AATT 5 cut(s) 270, 362, 393, 599, 742
TfiI GAWTC 5 cut(s) 405, 444, 450, 464, 473
Tru1I TTAA 1 cut(s) 564
Tru9I TTAA 1 cut(s) 564
TscAI CASTG 1 cut(s) 172
TspDTI ATGAA 5 cut(s) 72, 375, 442, 503, 531
TspGWI ACGGA 1 cut(s) 690
TspRI CASTG 1 cut(s) 172
XapI RAATTY 2 cut(s) 270, 362
XceI RCATGY 1 cut(s) 293
XcmI CCANNNNNNNNNTGG 1 cut(s) 215
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.