Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8239215.1

Orthogroup ID

OG0014727

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 713

Gene Structure 712 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8239215.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 712 bp

atgttaaaagccacttccggatccaagaggaaggagcatgttggggatctcaagaagccgaattgcaagaatccaaaatctggtgggattcgtggtgtatctagttatgatatttcactagatcaaggtgataaaaacgattacgagaatgaagtatcctcagccagtcaagaggttgtcggtgagaaagatgaagaagcatcatgtttagaaaaatcagaaactactttgggatccaagaggaagaattcgaatggtgataagcatgttaagcagccagattgtgagaatggtgatgggaatgttaagcagccagactgcaagaatggcaatggggatgttaagcagccagattgcaagaatggtgttggggataataagcagcacaagagattacgtcttgatcaagtacatagtcatgattgttcaaatttatctcaaaaatttagtgatacgtctttttgcggcattgaggacagtcttcaagatggcttttatgatgcgggacgtgataggccgttcatgccactggagagttatgatgaaaatttccctcttgactctcgtgaagttattttcttggacagcggaaaggatgatgagttggatggaatttttcagtctgccagagatgtggttcgccgtttgaatgagttaaatgataatcgcactgatgagcgacagattgcaatgtttcttgctctctttgtgt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EDR1 LRR_8 Pkinase

Protein Analysis

237

Amino Acids

26.44

Weight (kDa)

5.02

Isoelectric Point (pI)

42.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014727)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g29700
rosa_chinensis	RchiOBHm_Chr4g0437941
rosa_laevigata	RLG00000006400
rosa_multiflora	Rmu_co8239215.1_g000001 Rmu_co8446239.1_g000001 Rmu_sc0025141.1_g000002 Rmu_sc0028618.1_g000001
rosa_roxburghii	Rroxscaffold_5G00379100
rosa_rugosa	Rorug04G0305700
rosa_samantha	Rh4AG346600 Rh4AG357300 Rh4BG368200 Rh4CG382300 Rh4DG349200 Rh4DG363100
rosa_wichuraiana	Rw0G011540 Rw0G016130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	80
AccIII	TCCGGA	1 cut(s)	17
AciI	CCGC	3 cut(s)	465, 503, 588
AclWI	GGATC	5 cut(s)	15, 28, 54, 228, 241
AcsI	RAATTY	5 cut(s)	247, 430, 443, 547, 612
AfaI	GTAC	1 cut(s)	411
AfiI	CCNNNNNNNGG	1 cut(s)	80
AgsI	TTSAA	3 cut(s)	429, 485, 649
AjiI	CACGTC	1 cut(s)	509
AlwI	GGATC	5 cut(s)	15, 28, 54, 228, 241
Aor13HI	TCCGGA	1 cut(s)	17
AoxI	GGCC	1 cut(s)	515
ApeKI	GCWGC	4 cut(s)	274, 310, 346, 382
ApoI	RAATTY	5 cut(s)	247, 430, 443, 547, 612
AsuHPI	GGTGA	4 cut(s)	140, 194, 269, 305
AsuII	TTCGAA	1 cut(s)	251
BamHI	GGATCC	2 cut(s)	20, 233
BauI	CACGAG	1 cut(s)	564
BbsI	GAAGAC	1 cut(s)	473
BbvCI	CCTCAGC	1 cut(s)	160
BbvI	GCAGC	4 cut(s)	286, 322, 358, 394
BccI	CCATC	3 cut(s)	290, 482, 602
BceAI	ACGGC	2 cut(s)	502, 627
BciVI	GTATCC	1 cut(s)	166
BclI	TGATCA	1 cut(s)	403
BfaI	CTAG	2 cut(s)	102, 119
BfuI	GTATCC	1 cut(s)	166
BisI	GCNGC	5 cut(s)	275, 311, 347, 383, 466
BlsI	GCNGC	5 cut(s)	276, 312, 348, 384, 467
BmgBI	CACGTC	1 cut(s)	509
BmiI	GGNNCC	2 cut(s)	22, 235
BmsI	GCATC	2 cut(s)	209, 490
BpiI	GAAGAC	1 cut(s)	473
BpmI	CTGGAG	1 cut(s)	551
Bpu10I	CCTNAGC	1 cut(s)	160
Bpu14I	TTCGAA	1 cut(s)	251
BpuEI	CTTGAG	1 cut(s)	35
BsaWI	WCCGGW	1 cut(s)	17
Bsc4I	CCNNNNNNNGG	1 cut(s)	80
Bse1I	ACTGG	2 cut(s)	165, 534
Bse3DI	GCAATG	2 cut(s)	337, 696
BseAI	TCCGGA	1 cut(s)	17
BseGI	GGATG	3 cut(s)	343, 601, 613
BseLI	CCNNNNNNNGG	1 cut(s)	80
BseMI	GCAATG	2 cut(s)	337, 696
BseMII	CTCAG	1 cut(s)	174
BseNI	ACTGG	2 cut(s)	165, 534
BseXI	GCAGC	4 cut(s)	286, 322, 358, 394
BshFI	GGCC	1 cut(s)	517
BsiSI	CCGG	1 cut(s)	18
BslFI	GGGAC	1 cut(s)	519
BslI	CCNNNNNNNGG	1 cut(s)	80
BsmFI	GGGAC	1 cut(s)	519
BsnI	GGCC	1 cut(s)	517
Bsp119I	TTCGAA	1 cut(s)	251
Bsp13I	TCCGGA	1 cut(s)	17
Bsp143I	GATC	5 cut(s)	20, 46, 121, 233, 403
BspACI	CCGC	3 cut(s)	465, 503, 588
BspANI	GGCC	1 cut(s)	517
BspCNI	CTCAG	1 cut(s)	173
BspEI	TCCGGA	1 cut(s)	17
BspHI	TCATGA	1 cut(s)	418
BspLI	GGNNCC	2 cut(s)	22, 235
BspPI	GGATC	5 cut(s)	15, 28, 54, 228, 241
BspT104I	TTCGAA	1 cut(s)	251
BsrDI	GCAATG	2 cut(s)	337, 696
BsrI	ACTGG	2 cut(s)	165, 534
BssMI	GATC	5 cut(s)	20, 46, 121, 233, 403
BssSI	CACGAG	1 cut(s)	564
Bst2BI	CACGAG	1 cut(s)	564
Bst4CI	ACNGT	1 cut(s)	479
BstBI	TTCGAA	1 cut(s)	251
BstDEI	CTNAG	1 cut(s)	160
BstF5I	GGATG	3 cut(s)	343, 601, 613
BstKTI	GATC	5 cut(s)	23, 49, 124, 236, 406
BstMBI	GATC	5 cut(s)	20, 46, 121, 233, 403
BstMWI	GCNNNNNNNGC	3 cut(s)	271, 327, 523
BstNSI	RCATGY	2 cut(s)	41, 269
BstV1I	GCAGC	4 cut(s)	286, 322, 358, 394
BstV2I	GAAGAC	1 cut(s)	473
BstX2I	RGATCY	3 cut(s)	20, 46, 233
BstXI	CCANNNNNNTGG	1 cut(s)	634
BstYI	RGATCY	3 cut(s)	20, 46, 233
BsuI	GTATCC	1 cut(s)	166
BsuRI	GGCC	1 cut(s)	517
BtrI	CACGTC	1 cut(s)	509
BtsCI	GGATG	3 cut(s)	343, 601, 613
BtsIMutI	CAGTG	2 cut(s)	527, 669
CciI	TCATGA	1 cut(s)	418
Csp6I	GTAC	1 cut(s)	410
CviAII	CATG	5 cut(s)	38, 204, 266, 419, 523
CviJI	RGCY	8 cut(s)	11, 58, 164, 277, 313, 349, 492, 517
CviKI_1	RGCY	8 cut(s)	11, 58, 164, 277, 313, 349, 492, 517
CviQI	GTAC	1 cut(s)	410
DdeI	CTNAG	1 cut(s)	160
DpnI	GATC	5 cut(s)	22, 48, 123, 235, 405
DpnII	GATC	5 cut(s)	20, 46, 121, 233, 403
EcoRI	GAATTC	1 cut(s)	247
FaeI	CATG	5 cut(s)	41, 207, 269, 422, 526
FaiI	YATR	9 cut(s)	39, 108, 205, 267, 414, 420, 498, 524, 540
FaqI	GGGAC	1 cut(s)	519
FatI	CATG	5 cut(s)	37, 203, 265, 418, 522
FauI	CCCGC	1 cut(s)	496
FbaI	TGATCA	1 cut(s)	403
Fnu4HI	GCNGC	5 cut(s)	275, 311, 347, 383, 466
FokI	GGATG	3 cut(s)	350, 608, 620
Fsp4HI	GCNGC	5 cut(s)	275, 311, 347, 383, 466
FspBI	CTAG	2 cut(s)	102, 119
GluI	GCNGC	5 cut(s)	275, 311, 347, 383, 466
GsuI	CTGGAG	1 cut(s)	551
HaeIII	GGCC	1 cut(s)	517
HapII	CCGG	1 cut(s)	18
Hin1II	CATG	5 cut(s)	41, 207, 269, 422, 526
HinfI	GANTC	3 cut(s)	70, 88, 560
HpaII	CCGG	1 cut(s)	18
HphI	GGTGA	4 cut(s)	140, 194, 269, 305
Hpy188I	TCNGA	1 cut(s)	220
Hpy188III	TCNNGA	8 cut(s)	18, 52, 170, 401, 419, 485, 557, 566
HpyAV	CCTTC	1 cut(s)	25
HpyCH4III	ACNGT	1 cut(s)	479
HpyCH4IV	ACGT	3 cut(s)	397, 455, 508
HpyCH4V	TGCA	4 cut(s)	66, 321, 357, 689
HpyF10VI	GCNNNNNNNGC	3 cut(s)	271, 327, 523
HpyF3I	CTNAG	1 cut(s)	160
HpySE526I	ACGT	3 cut(s)	397, 455, 508
Hsp92II	CATG	5 cut(s)	41, 207, 269, 422, 526
Kpn2I	TCCGGA	1 cut(s)	17
Ksp22I	TGATCA	1 cut(s)	403
Kzo9I	GATC	5 cut(s)	20, 46, 121, 233, 403
LmnI	GCTCC	1 cut(s)	34
LpnPI	CCDG	8 cut(s)	31, 66, 178, 291, 327, 363, 515, 640
Lsp1109I	GCAGC	4 cut(s)	286, 322, 358, 394
LweI	GCATC	2 cut(s)	209, 490
MaeI	CTAG	2 cut(s)	102, 119
MaeII	ACGT	3 cut(s)	397, 455, 508
MalI	GATC	5 cut(s)	22, 48, 123, 235, 405
MboI	GATC	5 cut(s)	20, 46, 121, 233, 403
MboII	GAAGA	3 cut(s)	206, 256, 473
MflI	RGATCY	3 cut(s)	20, 46, 233
MluCI	AATT	6 cut(s)	61, 247, 430, 443, 547, 612
MlyI	GAGTC	1 cut(s)	554
MmeI	TCCRAC	1 cut(s)	585
MnlI	CCTC	6 cut(s)	21, 166, 169, 234, 466, 564
MroI	TCCGGA	1 cut(s)	17
MseI	TTAA	5 cut(s)	5, 270, 306, 342, 656
MslI	CAYNNNNRTG	1 cut(s)	417
MspA1I	CMGCKG	1 cut(s)	588
MspI	CCGG	1 cut(s)	18
MwoI	GCNNNNNNNGC	3 cut(s)	271, 327, 523
NdeII	GATC	5 cut(s)	20, 46, 121, 233, 403
NlaIII	CATG	5 cut(s)	41, 207, 269, 422, 526
NlaIV	GGNNCC	2 cut(s)	22, 235
NspI	RCATGY	2 cut(s)	41, 269
NspV	TTCGAA	1 cut(s)	251
PagI	TCATGA	1 cut(s)	418
PfeI	GAWTC	2 cut(s)	70, 88
PflMI	CCANNNNNTGG	1 cut(s)	80
PkrI	GCNGC	5 cut(s)	276, 312, 348, 384, 467
PleI	GAGTC	1 cut(s)	554
PpsI	GAGTC	1 cut(s)	554
PspN4I	GGNNCC	2 cut(s)	22, 235
PsuI	RGATCY	3 cut(s)	20, 46, 233
RsaI	GTAC	1 cut(s)	411
RsaNI	GTAC	1 cut(s)	410
RseI	CAYNNNNRTG	1 cut(s)	417
SaqAI	TTAA	5 cut(s)	5, 270, 306, 342, 656
SatI	GCNGC	5 cut(s)	275, 311, 347, 383, 466
Sau3AI	GATC	5 cut(s)	20, 46, 121, 233, 403
SchI	GAGTC	1 cut(s)	554
SetI	ASST	5 cut(s)	130, 177, 400, 458, 511
SfaNI	GCATC	2 cut(s)	209, 490
SfuI	TTCGAA	1 cut(s)	251
SmiMI	CAYNNNNRTG	1 cut(s)	417
SmlI	CTYRAG	1 cut(s)	50
SmoI	CTYRAG	1 cut(s)	50
Sse9I	AATT	6 cut(s)	61, 247, 430, 443, 547, 612
SsiI	CCGC	3 cut(s)	465, 503, 588
SspMI	CTAG	2 cut(s)	102, 119
TaaI	ACNGT	1 cut(s)	479
TaiI	ACGT	3 cut(s)	400, 458, 511
TaqI	TCGA	1 cut(s)	251
TasI	AATT	6 cut(s)	61, 247, 430, 443, 547, 612
TatI	WGTACW	1 cut(s)	409
TauI	GCSGC	1 cut(s)	468
TfiI	GAWTC	2 cut(s)	70, 88
Tru1I	TTAA	5 cut(s)	5, 270, 306, 342, 656
Tru9I	TTAA	5 cut(s)	5, 270, 306, 342, 656
TscAI	CASTG	2 cut(s)	534, 676
TseI	GCWGC	4 cut(s)	274, 310, 346, 382
TspDTI	ATGAA	4 cut(s)	165, 207, 511, 558
TspRI	CASTG	2 cut(s)	534, 676
Van91I	CCANNNNNTGG	1 cut(s)	80
XapI	RAATTY	5 cut(s)	247, 430, 443, 547, 612
XceI	RCATGY	2 cut(s)	41, 269
XspI	CTAG	2 cut(s)	102, 119

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.