Rorug04G0305700

Ethylene-responsive protein kinase Le-CTR1

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
48195915 .. 48196789
875 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0305700.1

Sequence Viewer

Length: 225 bp
ATGGCTTCTTGGAAGAAAACCATCACAACCCCATTCAGGAAAGCTTGCAAGGTCTTCAACCAGCAGCCAAGTACCAGAGACCAGAAGAAGTCTCAACTTCAAGGGAATGAGAATAGTGTGACTGCTCTGCATGGTGAAGTGATGGCTTGTGGCTATGAAGATGTTCAGGTCATGTGGTCTATTCTGGACAAGTCCAACTCCTCAGCCTGCAACATCACTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.26

Weight (kDa)

8.93

Isoelectric Point (pI)

50.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 73
AfiI CCNNNNNNNGG 1 cut(s) 36
AgsI TTSAA 2 cut(s) 58, 101
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
Alw26I GTCTC 2 cut(s) 72, 96
ApeKI GCWGC 1 cut(s) 64
Asp700I GAANNNNTTC 1 cut(s) 162
AsuHPI GGTGA 1 cut(s) 146
BbsI GAAGAC 1 cut(s) 46
BbvCI CCTCAGC 1 cut(s) 202
BbvI GCAGC 1 cut(s) 76
BccI CCATC 2 cut(s) 29, 136
BcoDI GTCTC 2 cut(s) 72, 96
BisI GCNGC 1 cut(s) 65
BlsI GCNGC 1 cut(s) 66
BpiI GAAGAC 1 cut(s) 46
Bpu10I CCTNAGC 1 cut(s) 202
BsaI GGTCTC 1 cut(s) 72
Bsc4I CCNNNNNNNGG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 36
BseMII CTCAG 1 cut(s) 216
BseRI GAGGAG 1 cut(s) 190
BseXI GCAGC 1 cut(s) 76
BslI CCNNNNNNNGG 1 cut(s) 36
BsmAI GTCTC 2 cut(s) 72, 96
Bso31I GGTCTC 1 cut(s) 72
BspCNI CTCAG 1 cut(s) 215
BspTNI GGTCTC 1 cut(s) 72
BstC8I GCNNGC 2 cut(s) 46, 208
BstDEI CTNAG 1 cut(s) 202
BstMAI GTCTC 2 cut(s) 72, 96
BstV1I GCAGC 1 cut(s) 76
BstV2I GAAGAC 1 cut(s) 46
Cac8I GCNNGC 2 cut(s) 46, 208
Csp6I GTAC 1 cut(s) 72
CviAII CATG 2 cut(s) 131, 172
CviJI RGCY 6 cut(s) 5, 44, 67, 146, 153, 206
CviKI_1 RGCY 6 cut(s) 5, 44, 67, 146, 153, 206
CviQI GTAC 1 cut(s) 72
DdeI CTNAG 1 cut(s) 202
Eco31I GGTCTC 1 cut(s) 72
FaeI CATG 2 cut(s) 134, 175
FaiI YATR 3 cut(s) 132, 156, 173
FatI CATG 2 cut(s) 130, 171
Fnu4HI GCNGC 1 cut(s) 65
Fsp4HI GCNGC 1 cut(s) 65
GluI GCNGC 1 cut(s) 65
Hin1II CATG 2 cut(s) 134, 175
HindIII AAGCTT 1 cut(s) 42
HphI GGTGA 1 cut(s) 146
Hpy188III TCNNGA 2 cut(s) 37, 185
HpyCH4V TGCA 3 cut(s) 48, 130, 210
HpyF3I CTNAG 1 cut(s) 202
Hsp92II CATG 2 cut(s) 134, 175
LpnPI CCDG 7 cut(s) 22, 74, 88, 95, 152, 170, 220
Lsp1109I GCAGC 1 cut(s) 76
MaeIII GTNAC 1 cut(s) 118
MboII GAAGA 4 cut(s) 25, 46, 97, 170
MmeI TCCRAC 1 cut(s) 219
MnlI CCTC 1 cut(s) 211
MroXI GAANNNNTTC 1 cut(s) 162
MseI TTAA 1 cut(s) 223
NlaIII CATG 2 cut(s) 134, 175
NmuCI GTSAC 1 cut(s) 118
PdmI GAANNNNTTC 1 cut(s) 162
PkrI GCNGC 1 cut(s) 66
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
SaqAI TTAA 1 cut(s) 223
SatI GCNGC 1 cut(s) 65
SetI ASST 3 cut(s) 46, 54, 171
Tru1I TTAA 1 cut(s) 223
Tru9I TTAA 1 cut(s) 223
TseFI GTSAC 1 cut(s) 118
TseI GCWGC 1 cut(s) 64
Tsp45I GTSAC 1 cut(s) 118
TspDTI ATGAA 1 cut(s) 171
XmnI GAANNNNTTC 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.