Rmu_co8249425.1_g000001

Acetyltransferase (GNAT) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8249425.1
Physical Location & Seq
Forward (+)
1 .. 528
528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8249425.1_g000001.1.cds

Sequence Viewer

Length: 182 bp
tggtgggttttggccgagctgtttctgatcaaggattgacagcctccatctacgatgttatggttattccttcattgcagggtatgggaattggcaagatgatagttaaaagaatcacaagaatactcacaagtagagacatttatgacatagcagccctttgctcagagagtgagaggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.4

Weight (kDa)

8.13

Isoelectric Point (pI)

47.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 12
AluBI AGCT 1 cut(s) 19
AluI AGCT 1 cut(s) 19
Alw26I GTCTC 1 cut(s) 131
AoxI GGCC 1 cut(s) 12
ApeKI GCWGC 1 cut(s) 154
BbvI GCAGC 1 cut(s) 166
BccI CCATC 1 cut(s) 55
BclI TGATCA 1 cut(s) 27
BcoDI GTCTC 1 cut(s) 131
BisI GCNGC 1 cut(s) 155
BlsI GCNGC 1 cut(s) 156
Bse3DI GCAATG 1 cut(s) 73
BseMI GCAATG 1 cut(s) 73
BseMII CTCAG 1 cut(s) 179
BseXI GCAGC 1 cut(s) 166
BshFI GGCC 1 cut(s) 14
BsmAI GTCTC 1 cut(s) 131
BsnI GGCC 1 cut(s) 14
Bsp143I GATC 1 cut(s) 27
BspANI GGCC 1 cut(s) 14
BspCNI CTCAG 1 cut(s) 178
BsrDI GCAATG 1 cut(s) 73
BssMI GATC 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 165
BstKTI GATC 1 cut(s) 30
BstMAI GTCTC 1 cut(s) 131
BstMBI GATC 1 cut(s) 27
BstV1I GCAGC 1 cut(s) 166
BsuRI GGCC 1 cut(s) 14
CviJI RGCY 4 cut(s) 14, 19, 43, 157
CviKI_1 RGCY 4 cut(s) 14, 19, 43, 157
DdeI CTNAG 1 cut(s) 165
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
EaeI YGGCCR 1 cut(s) 12
FaiI YATR 4 cut(s) 61, 85, 146, 151
FbaI TGATCA 1 cut(s) 27
Fnu4HI GCNGC 1 cut(s) 155
Fsp4HI GCNGC 1 cut(s) 155
GluI GCNGC 1 cut(s) 155
HaeIII GGCC 1 cut(s) 14
HinfI GANTC 1 cut(s) 113
Hpy188I TCNGA 2 cut(s) 27, 168
HpyAV CCTTC 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 78
HpyF3I CTNAG 1 cut(s) 165
Ksp22I TGATCA 1 cut(s) 27
Kzo9I GATC 1 cut(s) 27
LpnPI CCDG 1 cut(s) 64
Lsp1109I GCAGC 1 cut(s) 166
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MluCI AATT 1 cut(s) 89
MnlI CCTC 2 cut(s) 54, 170
MseI TTAA 1 cut(s) 107
NdeII GATC 1 cut(s) 27
NmeAIII GCCGAG 1 cut(s) 40
PfeI GAWTC 1 cut(s) 113
PkrI GCNGC 1 cut(s) 156
SaqAI TTAA 1 cut(s) 107
SatI GCNGC 1 cut(s) 155
Sau3AI GATC 1 cut(s) 27
SetI ASST 2 cut(s) 21, 181
SgeI CNNG 6 cut(s) 28, 43, 91, 108, 131, 143
Sse9I AATT 1 cut(s) 89
TasI AATT 1 cut(s) 89
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TseI GCWGC 1 cut(s) 154
TspDTI ATGAA 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.