Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0032706.1

Orthogroup ID

OG0009063

Physical Location & Seq

Genomic Coordinates Reverse (-)

589 .. 1236

Gene Structure 648 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0032706.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 648 bp

atgaccataaatgtaaatgaaatcgagttctgctttgtaggaaatgagggaggacctggggatcacagcaatactatcaccttggctaccggagatggatctgcaccagcattactaccatttactccacaaaagagaccagaacatcaattccaaatgaattccccctatgcaaatccaatgccttcgactacatactattcgaaaccatctgctgttggaccaagttacacaccagcaagcggaccaagctacacgccagcaagcggaccaggcaacctgccagcaaatggaccaggctacctgccagcaagcggaccaagctacctgccagcaagtggaccaagctatcagccttctagaactcctccaccgcctccaccaccgtccaatgttggatatgtacctacttttctccccaggacagatcaaatgactgacacctatatcaatatgccctcatcatctggagcaccacctcctggtcgtggaactcgggccggaggacctgcttttgcaatgggaatgggtgctggagcgctggcagccggtgcggtgatcttcggtgatgattttatgtcaggatttgatgttccttcaggcttacaagatgctagtgttacaatatcagctgatcctcctttctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

215

Amino Acids

21.88

Weight (kDa)

4.54

Isoelectric Point (pI)

56.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009063)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G19985 AT4G19985 AT4G19985 AT4G19985 AT4G19985 AT4G19985 AT4G19985
fragaria_vesca	FvH4_7g26320
malus_domestica	MD07G1238600.v1.1
prunus_persica	Prupe.2G267400_v2.0.a1
pyrus_communis	pycom07g21460
rosa_chinensis	RchiOBHm_Chr1g0372781
rosa_multiflora	Rmu_co8249425.1_g000001 Rmu_sc0009717.1_g000005 Rmu_sc0032706.1_g000001
rosa_roxburghii	Rroxscaffold_4G00284690
rosa_rugosa	Rorug01G0374300
rosa_samantha	Rh1BG346600 Rh1BG346700 Rh1CG359800 Rh1CG360000
rosa_wichuraiana	Rw1G033720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	4 cut(s)	288, 312, 336, 517
AccB7I	CCANNNNNTGG	3 cut(s)	290, 338, 482
AciI	CCGC	5 cut(s)	243, 267, 315, 374, 554
AclWI	GGATC	3 cut(s)	69, 106, 629
AcsI	RAATTY	1 cut(s)	160
AcuI	CTGAAG	1 cut(s)	582
AfaI	GTAC	1 cut(s)	405
AfeI	AGCGCT	1 cut(s)	540
AfiI	CCNNNNNNNGG	7 cut(s)	242, 266, 290, 314, 338, 482, 488
AjnI	CCWGG	5 cut(s)	55, 271, 295, 419, 481
AloI	GAACNNNNNNTCC	4 cut(s)	135, 167, 576, 608
AluBI	AGCT	4 cut(s)	252, 324, 348, 632
AluI	AGCT	4 cut(s)	252, 324, 348, 632
Alw21I	GWGCWC	1 cut(s)	475
Alw26I	GTCTC	1 cut(s)	130
AlwI	GGATC	3 cut(s)	69, 106, 629
Ama87I	CYCGRG	1 cut(s)	495
Aor51HI	AGCGCT	1 cut(s)	540
AoxI	GGCC	1 cut(s)	498
ApeKI	GCWGC	1 cut(s)	545
ApoI	RAATTY	1 cut(s)	160
AspLEI	GCGC	1 cut(s)	541
AspS9I	GGNCC	9 cut(s)	53, 221, 245, 269, 293, 317, 341, 498, 506
AsuHPI	GGTGA	3 cut(s)	70, 568, 578
AsuII	TTCGAA	1 cut(s)	203
AvaI	CYCGRG	1 cut(s)	495
AvaII	GGWCC	8 cut(s)	53, 221, 245, 269, 293, 317, 341, 506
Bbv12I	GWGCWC	1 cut(s)	475
BbvI	GCAGC	1 cut(s)	557
BccI	CCATC	2 cut(s)	89, 217
BciT130I	CCWGG	5 cut(s)	57, 273, 297, 421, 483
BcoDI	GTCTC	1 cut(s)	130
BfaI	CTAG	2 cut(s)	360, 615
BfoI	RGCGCY	1 cut(s)	542
BfuAI	ACCTGC	4 cut(s)	288, 312, 336, 517
BisI	GCNGC	1 cut(s)	546
BlsI	GCNGC	1 cut(s)	547
Bme1390I	CCNGG	5 cut(s)	57, 273, 297, 421, 483
Bme18I	GGWCC	8 cut(s)	53, 221, 245, 269, 293, 317, 341, 506
BmeT110I	CYCGRG	1 cut(s)	495
BmgT120I	GGNCC	9 cut(s)	53, 221, 245, 269, 293, 317, 341, 498, 506
BmrFI	CCNGG	5 cut(s)	57, 273, 297, 421, 483
BmsI	GCATC	1 cut(s)	601
BpmI	CTGGAG	2 cut(s)	489, 555
Bpu14I	TTCGAA	1 cut(s)	203
BsaI	GGTCTC	1 cut(s)	130
BsaJI	CCNNGG	3 cut(s)	56, 81, 419
BsaWI	WCCGGW	1 cut(s)	89
Bsc4I	CCNNNNNNNGG	7 cut(s)	242, 266, 290, 314, 338, 482, 488
Bse118I	RCCGGY	1 cut(s)	548
Bse3DI	GCAATG	1 cut(s)	525
BseBI	CCWGG	5 cut(s)	57, 273, 297, 421, 483
BseDI	CCNNGG	3 cut(s)	56, 81, 419
BseLI	CCNNNNNNNGG	7 cut(s)	242, 266, 290, 314, 338, 482, 488
BseMI	GCAATG	1 cut(s)	525
BseRI	GAGGAG	1 cut(s)	357
BseXI	GCAGC	1 cut(s)	557
BsgI	GTGCAG	1 cut(s)	87
BshFI	GGCC	1 cut(s)	500
BsiHKAI	GWGCWC	1 cut(s)	475
BsiHKCI	CYCGRG	1 cut(s)	495
BsiSI	CCGG	3 cut(s)	90, 501, 549
BslI	CCNNNNNNNGG	7 cut(s)	242, 266, 290, 314, 338, 482, 488
BsmAI	GTCTC	1 cut(s)	130
BsnI	GGCC	1 cut(s)	500
Bso31I	GGTCTC	1 cut(s)	130
BsoBI	CYCGRG	1 cut(s)	495
Bsp119I	TTCGAA	1 cut(s)	203
Bsp1286I	GDGCHC	1 cut(s)	475
Bsp143I	GATC	5 cut(s)	61, 98, 427, 558, 634
BspACI	CCGC	5 cut(s)	243, 267, 315, 374, 554
BspANI	GGCC	1 cut(s)	500
BspMI	ACCTGC	4 cut(s)	288, 312, 336, 517
BspPI	GGATC	3 cut(s)	69, 106, 629
BspT104I	TTCGAA	1 cut(s)	203
BspTNI	GGTCTC	1 cut(s)	130
BsrDI	GCAATG	1 cut(s)	525
BsrFI	RCCGGY	1 cut(s)	548
BssAI	RCCGGY	1 cut(s)	548
BssECI	CCNNGG	3 cut(s)	56, 81, 419
BssMI	GATC	5 cut(s)	61, 98, 427, 558, 634
BssT1I	CCWWGG	1 cut(s)	81
Bst2UI	CCWGG	5 cut(s)	57, 273, 297, 421, 483
Bst4CI	ACNGT	1 cut(s)	387
BstAPI	GCANNNNNTGC	1 cut(s)	551
BstBI	TTCGAA	1 cut(s)	203
BstC8I	GCNNGC	8 cut(s)	241, 261, 265, 285, 309, 313, 333, 543
BstH2I	RGCGCY	1 cut(s)	542
BstHHI	GCGC	1 cut(s)	541
BstKTI	GATC	5 cut(s)	64, 101, 430, 561, 637
BstMAI	GTCTC	1 cut(s)	130
BstMBI	GATC	5 cut(s)	61, 98, 427, 558, 634
BstMWI	GCNNNNNNNGC	5 cut(s)	249, 273, 321, 545, 551
BstNI	CCWGG	5 cut(s)	57, 273, 297, 421, 483
BstSCI	CCNGG	5 cut(s)	55, 271, 295, 419, 481
BstV1I	GCAGC	1 cut(s)	557
BstX2I	RGATCY	1 cut(s)	98
BstYI	RGATCY	1 cut(s)	98
BsuRI	GGCC	1 cut(s)	500
BveI	ACCTGC	4 cut(s)	288, 312, 336, 517
Cac8I	GCNNGC	8 cut(s)	241, 261, 265, 285, 309, 313, 333, 543
CfoI	GCGC	1 cut(s)	541
Cfr10I	RCCGGY	1 cut(s)	548
Cfr13I	GGNCC	9 cut(s)	53, 221, 245, 269, 293, 317, 341, 498, 506
Csp6I	GTAC	1 cut(s)	404
CviQI	GTAC	1 cut(s)	404
DpnI	GATC	5 cut(s)	63, 100, 429, 560, 636
DpnII	GATC	5 cut(s)	61, 98, 427, 558, 634
Eco130I	CCWWGG	1 cut(s)	81
Eco31I	GGTCTC	1 cut(s)	130
Eco47I	GGWCC	8 cut(s)	53, 221, 245, 269, 293, 317, 341, 506
Eco47III	AGCGCT	1 cut(s)	540
Eco57I	CTGAAG	1 cut(s)	582
Eco88I	CYCGRG	1 cut(s)	495
EcoO109I	RGGNCCY	2 cut(s)	53, 506
EcoRI	GAATTC	1 cut(s)	160
EcoRII	CCWGG	5 cut(s)	55, 271, 295, 419, 481
EcoT14I	CCWWGG	1 cut(s)	81
ErhI	CCWWGG	1 cut(s)	81
FaiI	YATR	7 cut(s)	8, 171, 196, 402, 447, 455, 578
Fnu4HI	GCNGC	1 cut(s)	546
Fsp4HI	GCNGC	1 cut(s)	546
FspBI	CTAG	2 cut(s)	360, 615
GlaI	GCGC	1 cut(s)	540
GluI	GCNGC	1 cut(s)	546
GsuI	CTGGAG	2 cut(s)	489, 555
HaeII	RGCGCY	1 cut(s)	542
HaeIII	GGCC	1 cut(s)	500
HapII	CCGG	3 cut(s)	90, 501, 549
HhaI	GCGC	1 cut(s)	541
Hin6I	GCGC	1 cut(s)	539
HinP1I	GCGC	1 cut(s)	539
HpaII	CCGG	3 cut(s)	90, 501, 549
HphI	GGTGA	3 cut(s)	70, 568, 578
Hpy166II	GTNNAC	1 cut(s)	341
Hpy188III	TCNNGA	3 cut(s)	360, 468, 582
Hpy8I	GTNNAC	1 cut(s)	341
HpyAV	CCTTC	3 cut(s)	195, 366, 606
HpyCH4III	ACNGT	1 cut(s)	387
HpyCH4V	TGCA	3 cut(s)	104, 173, 518
HpyF10VI	GCNNNNNNNGC	5 cut(s)	249, 273, 321, 545, 551
HspAI	GCGC	1 cut(s)	539
Kzo9I	GATC	5 cut(s)	61, 98, 427, 558, 634
LmnI	GCTCC	2 cut(s)	470, 536
Lsp1109I	GCAGC	1 cut(s)	557
LweI	GCATC	1 cut(s)	601
MaeI	CTAG	2 cut(s)	360, 615
MaeIII	GTNAC	2 cut(s)	227, 619
MalI	GATC	5 cut(s)	63, 100, 429, 560, 636
MboI	GATC	5 cut(s)	61, 98, 427, 558, 634
MboII	GAAGA	1 cut(s)	553
MflI	RGATCY	1 cut(s)	98
MhlI	GDGCHC	1 cut(s)	475
MluCI	AATT	2 cut(s)	149, 160
MmeI	TCCRAC	2 cut(s)	199, 376
MnlI	CCTC	8 cut(s)	40, 44, 378, 387, 469, 489, 497, 648
MspA1I	CMGCKG	1 cut(s)	632
MspI	CCGG	3 cut(s)	90, 501, 549
MspR9I	CCNGG	5 cut(s)	57, 273, 297, 421, 483
MvaI	CCWGG	5 cut(s)	57, 273, 297, 421, 483
MwoI	GCNNNNNNNGC	5 cut(s)	249, 273, 321, 545, 551
NdeII	GATC	5 cut(s)	61, 98, 427, 558, 634
NspV	TTCGAA	1 cut(s)	203
PflMI	CCANNNNNTGG	3 cut(s)	290, 338, 482
PkrI	GCNGC	1 cut(s)	547
PpuMI	RGGWCCY	2 cut(s)	53, 506
Psp5II	RGGWCCY	2 cut(s)	53, 506
Psp6I	CCWGG	5 cut(s)	55, 271, 295, 419, 481
PspGI	CCWGG	5 cut(s)	55, 271, 295, 419, 481
PspPI	GGNCC	9 cut(s)	53, 221, 245, 269, 293, 317, 341, 498, 506
PspPPI	RGGWCCY	2 cut(s)	53, 506
PsuI	RGATCY	1 cut(s)	98
PvuII	CAGCTG	1 cut(s)	632
RsaI	GTAC	1 cut(s)	405
RsaNI	GTAC	1 cut(s)	404
SatI	GCNGC	1 cut(s)	546
Sau3AI	GATC	5 cut(s)	61, 98, 427, 558, 634
Sau96I	GGNCC	9 cut(s)	53, 221, 245, 269, 293, 317, 341, 498, 506
ScrFI	CCNGG	5 cut(s)	57, 273, 297, 421, 483
SduI	GDGCHC	1 cut(s)	475
SfaNI	GCATC	1 cut(s)	601
SfuI	TTCGAA	1 cut(s)	203
SinI	GGWCC	8 cut(s)	53, 221, 245, 269, 293, 317, 341, 506
Sse9I	AATT	2 cut(s)	149, 160
SsiI	CCGC	5 cut(s)	243, 267, 315, 374, 554
SspMI	CTAG	2 cut(s)	360, 615
StyD4I	CCNGG	5 cut(s)	55, 271, 295, 419, 481
StyI	CCWWGG	1 cut(s)	81
TaaI	ACNGT	1 cut(s)	387
TaqI	TCGA	3 cut(s)	24, 188, 203
TasI	AATT	2 cut(s)	149, 160
TseI	GCWGC	1 cut(s)	545
TspDTI	ATGAA	2 cut(s)	33, 173
Van91I	CCANNNNNTGG	3 cut(s)	290, 338, 482
VpaK11BI	GGWCC	8 cut(s)	53, 221, 245, 269, 293, 317, 341, 506
XapI	RAATTY	1 cut(s)	160
XbaI	TCTAGA	1 cut(s)	359
XspI	CTAG	2 cut(s)	360, 615

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.