Rmu_co8249681.1_g000001

pre-mRNA-splicing factor SPF27 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8249681.1
Physical Location & Seq
Forward (+)
1 .. 733
733 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8249681.1_g000001.1.cds

Sequence Viewer

Length: 253 bp
attgcagaaattaactcatgaacgctctcaaatgattggaactgtgaatcgtgaaaggaaagaacatcagcaaaacactgcatatgagcttaatgctttatctgcgcaatggaaggaactttctctgaaaaacatagaaattcaagccgcatgtgctaaaatagaaaattatatagatgaactcaaaaaggaagctgcagagagaggctgggacttaaaaccagtggagaatggcccgttgaattctgaatga

Protein Analysis

83

Amino Acids

9.59

Weight (kDa)

5.73

Isoelectric Point (pI)

40.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 106
AciI CCGC 1 cut(s) 148
AcsI RAATTY 2 cut(s) 139, 242
AgsI TTSAA 2 cut(s) 144, 242
AluBI AGCT 2 cut(s) 89, 195
AluI AGCT 2 cut(s) 89, 195
AoxI GGCC 1 cut(s) 233
ApeKI GCWGC 1 cut(s) 195
ApoI RAATTY 2 cut(s) 139, 242
AspLEI GCGC 1 cut(s) 107
AspS9I GGNCC 1 cut(s) 234
BbvI GCAGC 1 cut(s) 182
BfmI CTRYAG 1 cut(s) 196
BisI GCNGC 2 cut(s) 148, 196
BlsI GCNGC 2 cut(s) 149, 197
BmgT120I GGNCC 1 cut(s) 234
Bse1I ACTGG 1 cut(s) 222
Bse3DI GCAATG 1 cut(s) 114
BseMI GCAATG 1 cut(s) 114
BseNI ACTGG 1 cut(s) 222
BseXI GCAGC 1 cut(s) 182
BseYI CCCAGC 1 cut(s) 208
BshFI GGCC 1 cut(s) 235
BslFI GGGAC 1 cut(s) 225
BsmFI GGGAC 1 cut(s) 225
BsnI GGCC 1 cut(s) 235
BspACI CCGC 1 cut(s) 148
BspANI GGCC 1 cut(s) 235
BspHI TCATGA 1 cut(s) 17
BspMAI CTGCAG 1 cut(s) 200
BsrDI GCAATG 1 cut(s) 114
BsrI ACTGG 1 cut(s) 222
Bst4CI ACNGT 1 cut(s) 44
BstHHI GCGC 1 cut(s) 107
BstMWI GCNNNNNNNGC 2 cut(s) 102, 153
BstNSI RCATGY 1 cut(s) 154
BstSFI CTRYAG 1 cut(s) 196
BstV1I GCAGC 1 cut(s) 182
BsuRI GGCC 1 cut(s) 235
BtsI GCAGTG 1 cut(s) 76
BtsIMutI CAGTG 2 cut(s) 76, 229
CciI TCATGA 1 cut(s) 17
CfoI GCGC 1 cut(s) 107
Cfr13I GGNCC 1 cut(s) 234
CviAII CATG 2 cut(s) 18, 151
CviJI RGCY 5 cut(s) 89, 147, 195, 208, 235
CviKI_1 RGCY 5 cut(s) 89, 147, 195, 208, 235
EcoRI GAATTC 1 cut(s) 242
FaeI CATG 2 cut(s) 21, 154
FaiI YATR 7 cut(s) 19, 83, 85, 135, 152, 172, 174
FaqI GGGAC 1 cut(s) 225
FatI CATG 2 cut(s) 17, 150
FauNDI CATATG 1 cut(s) 83
Fnu4HI GCNGC 2 cut(s) 148, 196
Fsp4HI GCNGC 2 cut(s) 148, 196
FspI TGCGCA 1 cut(s) 106
GlaI GCGC 1 cut(s) 106
GluI GCNGC 2 cut(s) 148, 196
GsaI CCCAGC 1 cut(s) 212
HaeIII GGCC 1 cut(s) 235
HhaI GCGC 1 cut(s) 107
Hin1II CATG 2 cut(s) 21, 154
Hin6I GCGC 1 cut(s) 105
HinP1I GCGC 1 cut(s) 105
HinfI GANTC 1 cut(s) 47
Hpy188I TCNGA 2 cut(s) 127, 248
Hpy188III TCNNGA 2 cut(s) 18, 51
HpyAV CCTTC 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 44
HpyCH4V TGCA 3 cut(s) 5, 81, 198
HpyF10VI GCNNNNNNNGC 2 cut(s) 102, 153
Hsp92II CATG 2 cut(s) 21, 154
HspAI GCGC 1 cut(s) 105
LpnPI CCDG 2 cut(s) 194, 235
Lsp1109I GCAGC 1 cut(s) 182
MluCI AATT 4 cut(s) 9, 139, 167, 242
MnlI CCTC 1 cut(s) 198
MseI TTAA 3 cut(s) 12, 91, 216
MwoI GCNNNNNNNGC 2 cut(s) 102, 153
NdeI CATATG 1 cut(s) 83
NlaIII CATG 2 cut(s) 21, 154
NsbI TGCGCA 1 cut(s) 106
NspI RCATGY 1 cut(s) 154
PagI TCATGA 1 cut(s) 17
PfeI GAWTC 1 cut(s) 47
PkrI GCNGC 2 cut(s) 149, 197
PspFI CCCAGC 1 cut(s) 208
PspPI GGNCC 1 cut(s) 234
PstI CTGCAG 1 cut(s) 200
SaqAI TTAA 3 cut(s) 12, 91, 216
SatI GCNGC 2 cut(s) 148, 196
Sau96I GGNCC 1 cut(s) 234
SetI ASST 2 cut(s) 91, 197
SfcI CTRYAG 1 cut(s) 196
SgeI CNNG 7 cut(s) 30, 63, 156, 163, 221, 234, 248
Sse9I AATT 4 cut(s) 9, 139, 167, 242
SsiI CCGC 1 cut(s) 148
TaaI ACNGT 1 cut(s) 44
TasI AATT 4 cut(s) 9, 139, 167, 242
TauI GCSGC 1 cut(s) 150
TfiI GAWTC 1 cut(s) 47
Tru1I TTAA 3 cut(s) 12, 91, 216
Tru9I TTAA 3 cut(s) 12, 91, 216
TscAI CASTG 2 cut(s) 83, 229
TseI GCWGC 1 cut(s) 195
TspDTI ATGAA 2 cut(s) 34, 193
TspRI CASTG 2 cut(s) 83, 229
XapI RAATTY 2 cut(s) 139, 242
XceI RCATGY 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.