Rmu_co8259069.1_g000001

Domain associated at C-terminal with AAA

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8259069.1
OG0009643
Physical Location & Seq
Forward (+)
1 .. 622
622 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8259069.1_g000001.1.cds

Sequence Viewer

Length: 444 bp
tttacactctcgggtctactgaatgtcgtcgatggtctgtggtcaagttgcggtgatgagaggattattgtgttcaccaccaaccacaaggaacggctagaccctgcattgctgcggcctggtcgaatggatatgcaaattcatatgtcgtattgcacccctagagggtttaagaccttagcctcaaactaccttggcattcaggacaccagcgaacatcacctgtgtcaagaaattgaagggttgatggagagcacaaacatcacccccgcagaggtttgtgaggagcttatgaggggtgggggtgatactgatgatgctgatgttgctcttgaaggacttgtcgcttgtctgaagcgtaagaggctcgagaccaacaaggcagaagaagaagaggttgggaaagcaaagaggcagaaacagattaatgcatctgaaaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA AAA_assoc

Protein Analysis

147

Amino Acids

16.38

Weight (kDa)

5.01

Isoelectric Point (pI)

53.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 16
AciI CCGC 3 cut(s) 51, 115, 270
AcsI RAATTY 1 cut(s) 138
AcuI CTGAAG 1 cut(s) 374
AfiI CCNNNNNNNGG 2 cut(s) 165, 274
AgsI TTSAA 2 cut(s) 239, 335
AjnI CCWGG 1 cut(s) 118
AjuI GAANNNNNNNTTGG 2 cut(s) 381, 413
AluBI AGCT 1 cut(s) 289
AluI AGCT 1 cut(s) 289
Alw21I GWGCWC 1 cut(s) 257
Alw26I GTCTC 1 cut(s) 365
Ama87I CYCGRG 2 cut(s) 10, 368
AoxI GGCC 1 cut(s) 116
ApeKI GCWGC 1 cut(s) 112
ApoI RAATTY 1 cut(s) 138
AseI ATTAAT 1 cut(s) 426
AsuHPI GGTGA 5 cut(s) 65, 67, 212, 256, 317
AvaI CYCGRG 2 cut(s) 10, 368
Bbv12I GWGCWC 1 cut(s) 257
BbvI GCAGC 1 cut(s) 99
BccI CCATC 2 cut(s) 26, 241
BceAI ACGGC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 120
BcoDI GTCTC 1 cut(s) 365
BfaI CTAG 2 cut(s) 98, 162
BisI GCNGC 2 cut(s) 113, 116
BlsI GCNGC 2 cut(s) 114, 117
Bme1390I CCNGG 1 cut(s) 120
BmeT110I CYCGRG 2 cut(s) 10, 368
BmrFI CCNGG 1 cut(s) 120
BmsI GCATC 2 cut(s) 307, 440
Bpu10I CCTNAGC 1 cut(s) 178
BsaI GGTCTC 1 cut(s) 365
BsaJI CCNNGG 1 cut(s) 193
Bsc4I CCNNNNNNNGG 2 cut(s) 165, 274
Bse3DI GCAATG 1 cut(s) 107
BseBI CCWGG 1 cut(s) 120
BseDI CCNNGG 1 cut(s) 193
BseLI CCNNNNNNNGG 2 cut(s) 165, 274
BseMI GCAATG 1 cut(s) 107
BseRI GAGGAG 1 cut(s) 299
BseXI GCAGC 1 cut(s) 99
BshFI GGCC 1 cut(s) 118
BsiHKAI GWGCWC 1 cut(s) 257
BsiHKCI CYCGRG 2 cut(s) 10, 368
BslI CCNNNNNNNGG 2 cut(s) 165, 274
BsmAI GTCTC 1 cut(s) 365
BsmI GAATGC 1 cut(s) 198
BsnI GGCC 1 cut(s) 118
Bso31I GGTCTC 1 cut(s) 365
BsoBI CYCGRG 2 cut(s) 10, 368
Bsp1286I GDGCHC 1 cut(s) 257
BspACI CCGC 3 cut(s) 51, 115, 270
BspANI GGCC 1 cut(s) 118
BspTNI GGTCTC 1 cut(s) 365
BsrDI GCAATG 1 cut(s) 107
BssECI CCNNGG 1 cut(s) 193
BssT1I CCWWGG 1 cut(s) 193
Bst2UI CCWGG 1 cut(s) 120
Bst6I CTCTTC 1 cut(s) 387
BstDEI CTNAG 1 cut(s) 178
BstMAI GTCTC 1 cut(s) 365
BstMWI GCNNNNNNNGC 2 cut(s) 326, 364
BstNI CCWGG 1 cut(s) 120
BstSCI CCNGG 1 cut(s) 118
BstV1I GCAGC 1 cut(s) 99
BsuRI GGCC 1 cut(s) 118
CviJI RGCY 5 cut(s) 97, 118, 182, 289, 367
CviKI_1 RGCY 5 cut(s) 97, 118, 182, 289, 367
DdeI CTNAG 1 cut(s) 178
Eam1104I CTCTTC 1 cut(s) 387
EarI CTCTTC 1 cut(s) 387
Eco130I CCWWGG 1 cut(s) 193
Eco31I GGTCTC 1 cut(s) 365
Eco57I CTGAAG 1 cut(s) 374
Eco88I CYCGRG 2 cut(s) 10, 368
EcoRII CCWGG 1 cut(s) 118
EcoT14I CCWWGG 1 cut(s) 193
EcoT22I ATGCAT 1 cut(s) 433
ErhI CCWWGG 1 cut(s) 193
FaiI YATR 4 cut(s) 134, 144, 146, 293
FauI CCCGC 1 cut(s) 277
FauNDI CATATG 1 cut(s) 144
FblI GTMKAC 1 cut(s) 16
Fnu4HI GCNGC 2 cut(s) 113, 116
Fsp4HI GCNGC 2 cut(s) 113, 116
FspBI CTAG 2 cut(s) 98, 162
GluI GCNGC 2 cut(s) 113, 116
HaeIII GGCC 1 cut(s) 118
HphI GGTGA 5 cut(s) 65, 67, 212, 256, 317
Hpy166II GTNNAC 2 cut(s) 17, 75
Hpy188I TCNGA 2 cut(s) 354, 436
Hpy188III TCNNGA 4 cut(s) 203, 230, 332, 370
Hpy8I GTNNAC 2 cut(s) 17, 75
Hpy99I CGWCG 1 cut(s) 32
HpyAV CCTTC 2 cut(s) 233, 329
HpyCH4V TGCA 4 cut(s) 107, 136, 156, 431
HpyF10VI GCNNNNNNNGC 2 cut(s) 326, 364
HpyF3I CTNAG 1 cut(s) 178
LmnI GCTCC 1 cut(s) 286
LpnPI CCDG 6 cut(s) 105, 117, 132, 188, 223, 236
Lsp1109I GCAGC 1 cut(s) 99
LweI GCATC 2 cut(s) 307, 440
MaeI CTAG 2 cut(s) 98, 162
MboII GAAGA 3 cut(s) 398, 401, 404
MhlI GDGCHC 1 cut(s) 257
MluCI AATT 2 cut(s) 138, 234
MnlI CCTC 9 cut(s) 54, 158, 193, 268, 277, 288, 357, 388, 405
Mph1103I ATGCAT 1 cut(s) 433
MseI TTAA 2 cut(s) 171, 426
MspR9I CCNGG 1 cut(s) 120
Mva1269I GAATGC 1 cut(s) 198
MvaI CCWGG 1 cut(s) 120
MwoI GCNNNNNNNGC 2 cut(s) 326, 364
NdeI CATATG 1 cut(s) 144
NsiI ATGCAT 1 cut(s) 433
PaeR7I CTCGAG 1 cut(s) 368
PctI GAATGC 1 cut(s) 198
PkrI GCNGC 2 cut(s) 114, 117
PshBI ATTAAT 1 cut(s) 426
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
SaqAI TTAA 2 cut(s) 171, 426
SatI GCNGC 2 cut(s) 113, 116
ScrFI CCNGG 1 cut(s) 120
SduI GDGCHC 1 cut(s) 257
SetI ASST 6 cut(s) 179, 195, 225, 279, 291, 399
SfaNI GCATC 2 cut(s) 307, 440
Sfr274I CTCGAG 1 cut(s) 368
SlaI CTCGAG 1 cut(s) 368
SmlI CTYRAG 1 cut(s) 368
SmoI CTYRAG 1 cut(s) 368
Sse9I AATT 2 cut(s) 138, 234
SsiI CCGC 3 cut(s) 51, 115, 270
SspMI CTAG 2 cut(s) 98, 162
StyD4I CCNGG 1 cut(s) 118
StyI CCWWGG 1 cut(s) 193
TaqI TCGA 3 cut(s) 30, 124, 369
TasI AATT 2 cut(s) 138, 234
TauI GCSGC 1 cut(s) 118
Tru1I TTAA 2 cut(s) 171, 426
Tru9I TTAA 2 cut(s) 171, 426
TseI GCWGC 1 cut(s) 112
TspDTI ATGAA 1 cut(s) 131
VspI ATTAAT 1 cut(s) 426
XapI RAATTY 1 cut(s) 138
XhoI CTCGAG 1 cut(s) 368
XmiI GTMKAC 1 cut(s) 16
XspI CTAG 2 cut(s) 98, 162
Zsp2I ATGCAT 1 cut(s) 433
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.