Rmu_co8276251.1_g000001

Double-stranded RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8276251.1
Physical Location & Seq
Reverse (-)
2 .. 682
681 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8276251.1_g000001.1.cds

Sequence Viewer

Length: 681 bp
atgaattatgccgttcctgtatatcagtgtcagagggatacttcttctagcaaagtaccactgtattcatgtactgtcgagattgggggaattcgttatattggagctgcagcaacaaccaaaaaggaagctgagataaaagtggctagaactgctcttctagctctcttgttaagtgatactgagtcatccatgggatcagttggcagctctgagttaacagtgcttccatctaaaagaaagcggtcagaatgtgaagagatttctaatgaacctaaaccaaagaaacccccatataagaggagaacgttcaaaaagaaagcctatgaagaaaaggtgggccagactgaagttggaaatatagcaccaggatcagagagtaatgaatccgttaagccaatgactgcagaagctatgccacaagagccagtgtccgaggatattccccatgctaataatgtcaatgctgaacatgggccgtcaatagcttcagatttcaccaacagcagcattgtgagtgggaatgtgggttcagtttcactgtcctgtggaaacataactactttggccaaggaagtggatatggtgtctgctgttaagccaatgactgcagaagctttgccacaagactcagtgtctgagtatattacccgtgctaataatgtcaacgctgaacatggg
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

227

Amino Acids

24.27

Weight (kDa)

5.75

Isoelectric Point (pI)

51.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 244
AclI AACGTT 1 cut(s) 308
AclWI GGATC 2 cut(s) 205, 379
AcoI YGGCCR 1 cut(s) 567
AcsI RAATTY 1 cut(s) 90
AcuI CTGAAG 2 cut(s) 369, 474
AfaI GTAC 2 cut(s) 57, 73
AgsI TTSAA 1 cut(s) 313
AhdI GACNNNNNGTC 1 cut(s) 634
AjnI CCWGG 1 cut(s) 367
AloI GAACNNNNNNTCC 2 cut(s) 514, 546
AluBI AGCT 7 cut(s) 107, 131, 164, 210, 413, 488, 617
AluI AGCT 7 cut(s) 107, 131, 164, 210, 413, 488, 617
AlwI GGATC 2 cut(s) 205, 379
AlwNI CAGNNNCTG 1 cut(s) 638
AoxI GGCC 3 cut(s) 340, 476, 567
ApeKI GCWGC 4 cut(s) 107, 110, 207, 507
ApoI RAATTY 1 cut(s) 90
AspS9I GGNCC 2 cut(s) 340, 476
AsuHPI GGTGA 1 cut(s) 490
BalI TGGCCA 1 cut(s) 569
BbvI GCAGC 4 cut(s) 94, 122, 219, 519
BccI CCATC 1 cut(s) 238
BceAI ACGGC 1 cut(s) 463
BciT130I CCWGG 1 cut(s) 369
BciVI GTATCC 1 cut(s) 31
BfaI CTAG 3 cut(s) 48, 147, 161
BfmI CTRYAG 3 cut(s) 108, 405, 609
BfuI GTATCC 1 cut(s) 31
BisI GCNGC 4 cut(s) 108, 111, 208, 508
BlsI GCNGC 4 cut(s) 109, 112, 209, 509
Bme1390I CCNGG 1 cut(s) 369
BmeRI GACNNNNNGTC 1 cut(s) 634
BmgT120I GGNCC 2 cut(s) 340, 476
BmrFI CCNGG 1 cut(s) 369
BsaJI CCNNGG 3 cut(s) 192, 435, 570
Bse1I ACTGG 1 cut(s) 428
BseBI CCWGG 1 cut(s) 369
BseDI CCNNGG 3 cut(s) 192, 435, 570
BseGI GGATG 1 cut(s) 188
BseMII CTCAG 5 cut(s) 123, 174, 204, 630, 645
BseNI ACTGG 1 cut(s) 428
BseRI GAGGAG 1 cut(s) 316
BseXI GCAGC 4 cut(s) 94, 122, 219, 519
BshFI GGCC 3 cut(s) 342, 478, 569
BsnI GGCC 3 cut(s) 342, 478, 569
Bsp143I GATC 2 cut(s) 197, 371
Bsp19I CCATGG 1 cut(s) 192
BspACI CCGC 1 cut(s) 244
BspANI GGCC 3 cut(s) 342, 478, 569
BspCNI CTCAG 5 cut(s) 124, 175, 205, 631, 644
BspMAI CTGCAG 3 cut(s) 112, 409, 613
BspPI GGATC 2 cut(s) 205, 379
BspQI GCTCTTC 1 cut(s) 162
BsrI ACTGG 1 cut(s) 428
BssECI CCNNGG 3 cut(s) 192, 435, 570
BssMI GATC 2 cut(s) 197, 371
BssT1I CCWWGG 2 cut(s) 192, 570
Bst2UI CCWGG 1 cut(s) 369
Bst4CI ACNGT 4 cut(s) 63, 76, 223, 543
Bst6I CTCTTC 2 cut(s) 162, 252
BstDEI CTNAG 5 cut(s) 132, 183, 213, 631, 639
BstDSI CCRYGG 1 cut(s) 192
BstF5I GGATG 1 cut(s) 188
BstKTI GATC 2 cut(s) 200, 374
BstMBI GATC 2 cut(s) 197, 371
BstMWI GCNNNNNNNGC 3 cut(s) 152, 161, 424
BstNI CCWGG 1 cut(s) 369
BstSCI CCNGG 1 cut(s) 367
BstSFI CTRYAG 3 cut(s) 108, 405, 609
BstV1I GCAGC 4 cut(s) 94, 122, 219, 519
BstXI CCANNNNNNTGG 1 cut(s) 577
BsuI GTATCC 1 cut(s) 31
BsuRI GGCC 3 cut(s) 342, 478, 569
BtgI CCRYGG 1 cut(s) 192
BtsCI GGATG 1 cut(s) 188
BtsIMutI CAGTG 6 cut(s) 32, 59, 228, 435, 539, 639
CaiI CAGNNNCTG 1 cut(s) 638
Cfr13I GGNCC 2 cut(s) 340, 476
Csp6I GTAC 2 cut(s) 56, 72
CviAII CATG 5 cut(s) 69, 193, 449, 473, 677
CviQI GTAC 2 cut(s) 56, 72
DdeI CTNAG 5 cut(s) 132, 183, 213, 631, 639
DpnI GATC 2 cut(s) 199, 373
DpnII GATC 2 cut(s) 197, 371
DriI GACNNNNNGTC 1 cut(s) 634
EaeI YGGCCR 1 cut(s) 567
Eam1104I CTCTTC 2 cut(s) 162, 252
Eam1105I GACNNNNNGTC 1 cut(s) 634
EarI CTCTTC 2 cut(s) 162, 252
Eco130I CCWWGG 2 cut(s) 192, 570
Eco57I CTGAAG 2 cut(s) 369, 474
EcoRI GAATTC 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 367
EcoT14I CCWWGG 2 cut(s) 192, 570
ErhI CCWWGG 2 cut(s) 192, 570
FaeI CATG 5 cut(s) 72, 196, 452, 476, 680
FatI CATG 5 cut(s) 68, 192, 448, 472, 676
Fnu4HI GCNGC 4 cut(s) 108, 111, 208, 508
FokI GGATG 1 cut(s) 175
Fsp4HI GCNGC 4 cut(s) 108, 111, 208, 508
FspBI CTAG 3 cut(s) 48, 147, 161
GluI GCNGC 4 cut(s) 108, 111, 208, 508
HaeIII GGCC 3 cut(s) 342, 478, 569
Hin1II CATG 5 cut(s) 72, 196, 452, 476, 680
HincII GTYRAC 2 cut(s) 219, 667
HindII GTYRAC 2 cut(s) 219, 667
HindIII AAGCTT 1 cut(s) 615
HinfI GANTC 3 cut(s) 185, 386, 629
HpaI GTTAAC 1 cut(s) 219
HphI GGTGA 1 cut(s) 490
Hpy166II GTNNAC 2 cut(s) 219, 667
Hpy188I TCNGA 7 cut(s) 33, 214, 250, 376, 436, 493, 640
Hpy188III TCNNGA 1 cut(s) 79
Hpy8I GTNNAC 2 cut(s) 219, 667
HpyCH4III ACNGT 4 cut(s) 63, 76, 223, 543
HpyCH4IV ACGT 1 cut(s) 308
HpyCH4V TGCA 3 cut(s) 110, 407, 611
HpyF10VI GCNNNNNNNGC 3 cut(s) 152, 161, 424
HpyF3I CTNAG 5 cut(s) 132, 183, 213, 631, 639
HpySE526I ACGT 1 cut(s) 308
Hsp92II CATG 5 cut(s) 72, 196, 452, 476, 680
KspAI GTTAAC 1 cut(s) 219
Kzo9I GATC 2 cut(s) 197, 371
LguI GCTCTTC 1 cut(s) 162
LmnI GCTCC 1 cut(s) 104
LpnPI CCDG 6 cut(s) 30, 354, 356, 381, 441, 559
Lsp1109I GCAGC 4 cut(s) 94, 122, 219, 519
MaeI CTAG 3 cut(s) 48, 147, 161
MaeII ACGT 1 cut(s) 308
MalI GATC 2 cut(s) 199, 373
MboI GATC 2 cut(s) 197, 371
MboII GAAGA 4 cut(s) 36, 149, 269, 341
MlsI TGGCCA 1 cut(s) 569
MluCI AATT 2 cut(s) 4, 90
MluNI TGGCCA 1 cut(s) 569
MlyI GAGTC 2 cut(s) 194, 623
MmeI TCCRAC 1 cut(s) 334
MnlI CCTC 3 cut(s) 27, 294, 430
Mox20I TGGCCA 1 cut(s) 569
MscI TGGCCA 1 cut(s) 569
MseI TTAA 4 cut(s) 173, 218, 393, 597
Msp20I TGGCCA 1 cut(s) 569
MspR9I CCNGG 1 cut(s) 369
MvaI CCWGG 1 cut(s) 369
MwoI GCNNNNNNNGC 3 cut(s) 152, 161, 424
NcoI CCATGG 1 cut(s) 192
NdeII GATC 2 cut(s) 197, 371
NlaIII CATG 5 cut(s) 72, 196, 452, 476, 680
PciSI GCTCTTC 1 cut(s) 162
PfeI GAWTC 1 cut(s) 386
PkrI GCNGC 4 cut(s) 109, 112, 209, 509
PleI GAGTC 2 cut(s) 193, 623
PpsI GAGTC 2 cut(s) 193, 623
Psp1406I AACGTT 1 cut(s) 308
Psp6I CCWGG 1 cut(s) 367
PspGI CCWGG 1 cut(s) 367
PspPI GGNCC 2 cut(s) 340, 476
PstI CTGCAG 3 cut(s) 112, 409, 613
PstNI CAGNNNCTG 1 cut(s) 638
RsaI GTAC 2 cut(s) 57, 73
RsaNI GTAC 2 cut(s) 56, 72
SapI GCTCTTC 1 cut(s) 162
SaqAI TTAA 4 cut(s) 173, 218, 393, 597
SatI GCNGC 4 cut(s) 108, 111, 208, 508
Sau3AI GATC 2 cut(s) 197, 371
Sau96I GGNCC 2 cut(s) 340, 476
SchI GAGTC 2 cut(s) 194, 623
ScrFI CCNGG 1 cut(s) 369
SfcI CTRYAG 3 cut(s) 108, 405, 609
Sse9I AATT 2 cut(s) 4, 90
SsiI CCGC 1 cut(s) 244
SspMI CTAG 3 cut(s) 48, 147, 161
StyD4I CCNGG 1 cut(s) 367
StyI CCWWGG 2 cut(s) 192, 570
TaaI ACNGT 4 cut(s) 63, 76, 223, 543
TaiI ACGT 1 cut(s) 311
TaqI TCGA 1 cut(s) 78
TasI AATT 2 cut(s) 4, 90
TatI WGTACW 1 cut(s) 71
TfiI GAWTC 1 cut(s) 386
Tru1I TTAA 4 cut(s) 173, 218, 393, 597
Tru9I TTAA 4 cut(s) 173, 218, 393, 597
TscAI CASTG 6 cut(s) 32, 66, 228, 435, 546, 639
TseI GCWGC 4 cut(s) 107, 110, 207, 507
TspDTI ATGAA 5 cut(s) 17, 57, 285, 342, 399
TspGWI ACGGA 1 cut(s) 379
TspRI CASTG 6 cut(s) 32, 66, 228, 435, 546, 639
XapI RAATTY 1 cut(s) 90
XcmI CCANNNNNNNNNTGG 1 cut(s) 350
XspI CTAG 3 cut(s) 48, 147, 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.