Rmu_sc0005716.1_g000008

Double-stranded RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005716.1
Physical Location & Seq
Forward (+)
36530 .. 39956
3427 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005716.1_g000008.1.cds

Sequence Viewer

Length: 1785 bp
atggctaccaatgcagaatttaaaggtgtttcaaaatgctatgtattcaagagccggttgcaagagtatgcacagaaaatgggaataaagacaccagtatatgagactacaaaagaaggtccttcacatgagccttccttcaggtctactgtgatattaaatgatgttagatacgactctttgcttgggtttactaatcgtaaggcagctgaacagtcagctgctgaagttgctctggtggagttatctaaatctggtgatgctgcacaatgcatctctcaacctgttcatgaaattggcttatgcaaaaatctgcttcaagagtatgcacagaagatgaattatgctgttcctgtatatcagtgtcagagggatacttcttctagcaaagtaccactgtattcatgtactgtcgagattgggggaattcgttatattggagctgcagcaacaaccaaaaaggaagctgagataaaagtggctagaactgctcttctagctctcttgttaagtgatactgagtcatccatgggatcagttggcagctctgagttaacagtgcttccatctaaaagaaagcggtcagaatgtgaagagatttctaatgaacctaaaccaaagaaacccccatataagaggagaacgttcaaaaagaaagcctatgaagaaaaggtgggccagactgaagttggaaatatagcaccaggatcagagagtaatgaatccgttaagccaatgactgcagaagctatgccacaagagccagtgtccgaggatattccccatgctaataatgtcaatgctgaacatgggccgtcaatagcttcagatttcaccaacagcagcattgtgagtgggaatgtgggttcagtttcactgtcctgtggaaacataactactttggccaaggaagtggatatggtgtctgctgttaagccaatgactgcagaagctttgccacaagactcagtgtctgagtatattacccgtgctaataatgtcaacgctgaacatgggctggcaacagcttcagatttcaccaacagcagcaatggaagtggggatgtgggttcagtttcactgtcctgtggaaacacaactgctttgggtaaggaagtgaatatggtgtcttctgttaagccaatgactgcaggaactatgccacaagattcagtgtctgaggatattccccatgctaataatgtcaatgctgaacatgggctgtcaacagcttcagatttcaccaacagcagcaatgggagtggagatgtgggttcagtttcactgccctctggaaacataactactttggccaaggaagcggatatggtgtctgccgttaagccaatgactgcagaagctatgccacaagactcagtgtctgaggatattccccatgctaataatgttaatgctgagcagtcaacagcttcagatttcaccaacggcagcaatgggagttgggatgggggttcagtttcactgtcctgcggaaacacaactacttcggccaaggaagtgaatatggttgctgctgttaagccagtgtctgcagaaatgatgccacaagattcggtgtctgaggatattccccatgctaataatgtgaatgctgaacatgggccgtcagcagcttcagatttcactaacggcagcaatgtgagtggggatgtgggttcagtttcactgtcctctggagacataactacttcggccaaggaagtgaatatggtgtcttctggaccttgtttggaggcttcaagtgtcatgcccggacctgactaa
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

594

Amino Acids

62.09

Weight (kDa)

4.88

Isoelectric Point (pI)

41.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 146
AciI CCGC 3 cut(s) 580, 1322, 1491
AclI AACGTT 1 cut(s) 644
AclWI GGATC 2 cut(s) 541, 715
AcoI YGGCCR 4 cut(s) 903, 1311, 1509, 1713
AcsI RAATTY 2 cut(s) 17, 426
AcuI CTGAAG 8 cut(s) 124, 246, 705, 810, 1014, 1218, 1416, 1620
AfaI GTAC 2 cut(s) 393, 409
AgsI TTSAA 5 cut(s) 33, 49, 320, 649, 1761
AhdI GACNNNNNGTC 2 cut(s) 970, 1378
AjnI CCWGG 1 cut(s) 703
AloI GAACNNNNNNTCC 2 cut(s) 850, 882
Alw26I GTCTC 2 cut(s) 98, 1692
AlwI GGATC 2 cut(s) 541, 715
AlwNI CAGNNNCTG 5 cut(s) 224, 974, 1178, 1382, 1550
AoxI GGCC 7 cut(s) 676, 812, 903, 1311, 1509, 1622, 1713
ApoI RAATTY 2 cut(s) 17, 426
AspS9I GGNCC 6 cut(s) 119, 676, 812, 1622, 1742, 1775
AsuC2I CCSGG 1 cut(s) 1773
AsuHPI GGTGA 5 cut(s) 269, 826, 1030, 1234, 1432
AvaII GGWCC 3 cut(s) 119, 1742, 1775
BalI TGGCCA 2 cut(s) 905, 1313
BbsI GAAGAC 2 cut(s) 1122, 1728
BccI CCATC 2 cut(s) 574, 1460
BceAI ACGGC 5 cut(s) 799, 1322, 1462, 1609, 1666
BciT130I CCWGG 1 cut(s) 705
BciVI GTATCC 1 cut(s) 367
BcnI CCSGG 1 cut(s) 1773
BcoDI GTCTC 2 cut(s) 98, 1692
BfaI CTAG 3 cut(s) 384, 483, 497
BfmI CTRYAG 6 cut(s) 444, 741, 945, 1149, 1353, 1551
BfuI GTATCC 1 cut(s) 367
BlpI GCTNAGC 1 cut(s) 1416
Bme1390I CCNGG 2 cut(s) 705, 1773
Bme18I GGWCC 3 cut(s) 119, 1742, 1775
BmeRI GACNNNNNGTC 2 cut(s) 970, 1378
BmgT120I GGNCC 6 cut(s) 119, 676, 812, 1622, 1742, 1775
BmrFI CCNGG 2 cut(s) 705, 1773
BmsI GCATC 3 cut(s) 250, 282, 1551
BpiI GAAGAC 2 cut(s) 1122, 1728
BpmI CTGGAG 1 cut(s) 1716
Bpu1102I GCTNAGC 1 cut(s) 1416
BpuMI CCSGG 1 cut(s) 1773
BsaJI CCNNGG 6 cut(s) 528, 771, 906, 1314, 1512, 1716
Bse118I RCCGGY 1 cut(s) 54
Bse1I ACTGG 3 cut(s) 95, 764, 1544
Bse3DI GCAATG 4 cut(s) 1057, 1261, 1459, 1663
BseBI CCWGG 1 cut(s) 705
BseDI CCNNGG 6 cut(s) 528, 771, 906, 1314, 1512, 1716
BseGI GGATG 4 cut(s) 524, 1069, 1471, 1675
BseMI GCAATG 4 cut(s) 1057, 1261, 1459, 1663
BseNI ACTGG 3 cut(s) 95, 764, 1544
BseRI GAGGAG 1 cut(s) 652
BsgI GTGCAG 1 cut(s) 249
BshFI GGCC 7 cut(s) 678, 814, 905, 1313, 1511, 1624, 1715
BsiSI CCGG 2 cut(s) 55, 1773
BsmAI GTCTC 2 cut(s) 98, 1692
BsmI GAATGC 1 cut(s) 1615
BsnI GGCC 7 cut(s) 678, 814, 905, 1313, 1511, 1624, 1715
Bsp143I GATC 2 cut(s) 533, 707
Bsp1720I GCTNAGC 1 cut(s) 1416
Bsp19I CCATGG 1 cut(s) 528
BspACI CCGC 3 cut(s) 580, 1322, 1491
BspANI GGCC 7 cut(s) 678, 814, 905, 1313, 1511, 1624, 1715
BspHI TCATGA 1 cut(s) 289
BspMAI CTGCAG 6 cut(s) 448, 745, 949, 1153, 1357, 1555
BspPI GGATC 2 cut(s) 541, 715
BspQI GCTCTTC 1 cut(s) 498
BsrDI GCAATG 4 cut(s) 1057, 1261, 1459, 1663
BsrFI RCCGGY 1 cut(s) 54
BsrI ACTGG 3 cut(s) 95, 764, 1544
BssAI RCCGGY 1 cut(s) 54
BssECI CCNNGG 6 cut(s) 528, 771, 906, 1314, 1512, 1716
BssMI GATC 2 cut(s) 533, 707
BssT1I CCWWGG 5 cut(s) 528, 906, 1314, 1512, 1716
Bst2UI CCWGG 1 cut(s) 705
Bst4CI ACNGT 9 cut(s) 151, 216, 399, 412, 559, 879, 1083, 1485, 1689
Bst6I CTCTTC 2 cut(s) 498, 588
BstC8I GCNNGC 1 cut(s) 1020
BstDSI CCRYGG 1 cut(s) 528
BstF5I GGATG 4 cut(s) 524, 1069, 1471, 1675
BstKTI GATC 2 cut(s) 536, 710
BstMAI GTCTC 2 cut(s) 98, 1692
BstMBI GATC 2 cut(s) 533, 707
BstMWI GCNNNNNNNGC 6 cut(s) 11, 230, 488, 497, 760, 1319
BstNI CCWGG 1 cut(s) 705
BstSCI CCNGG 2 cut(s) 703, 1771
BstSFI CTRYAG 6 cut(s) 444, 741, 945, 1149, 1353, 1551
BstV2I GAAGAC 2 cut(s) 1122, 1728
BstXI CCANNNNNNTGG 1 cut(s) 913
BsuI GTATCC 1 cut(s) 367
BsuRI GGCC 7 cut(s) 678, 814, 905, 1313, 1511, 1624, 1715
BtgI CCRYGG 1 cut(s) 528
BtsCI GGATG 4 cut(s) 524, 1069, 1471, 1675
BtsI GCAGTG 1 cut(s) 1283
Cac8I GCNNGC 1 cut(s) 1020
CaiI CAGNNNCTG 5 cut(s) 224, 974, 1178, 1382, 1550
CciI TCATGA 1 cut(s) 289
Cfr10I RCCGGY 1 cut(s) 54
Cfr13I GGNCC 6 cut(s) 119, 676, 812, 1622, 1742, 1775
Csp6I GTAC 2 cut(s) 392, 408
CspCI CAANNNNNGTGG 6 cut(s) 1039, 1074, 1243, 1278, 1645, 1680
CviQI GTAC 2 cut(s) 392, 408
DpnI GATC 2 cut(s) 535, 709
DpnII GATC 2 cut(s) 533, 707
DraI TTTAAA 1 cut(s) 22
DriI GACNNNNNGTC 2 cut(s) 970, 1378
EaeI YGGCCR 4 cut(s) 903, 1311, 1509, 1713
Eam1104I CTCTTC 2 cut(s) 498, 588
Eam1105I GACNNNNNGTC 2 cut(s) 970, 1378
EarI CTCTTC 2 cut(s) 498, 588
Eco130I CCWWGG 5 cut(s) 528, 906, 1314, 1512, 1716
Eco47I GGWCC 3 cut(s) 119, 1742, 1775
Eco57I CTGAAG 8 cut(s) 124, 246, 705, 810, 1014, 1218, 1416, 1620
EcoO109I RGGNCCY 1 cut(s) 119
EcoRI GAATTC 1 cut(s) 426
EcoRII CCWGG 1 cut(s) 703
EcoT14I CCWWGG 5 cut(s) 528, 906, 1314, 1512, 1716
EcoT22I ATGCAT 1 cut(s) 275
ErhI CCWWGG 5 cut(s) 528, 906, 1314, 1512, 1716
FblI GTMKAC 1 cut(s) 146
FokI GGATG 4 cut(s) 511, 1076, 1478, 1682
FspBI CTAG 3 cut(s) 384, 483, 497
GsuI CTGGAG 1 cut(s) 1716
HaeIII GGCC 7 cut(s) 678, 814, 905, 1313, 1511, 1624, 1715
HapII CCGG 2 cut(s) 55, 1773
HincII GTYRAC 4 cut(s) 555, 1003, 1227, 1425
HindII GTYRAC 4 cut(s) 555, 1003, 1227, 1425
HindIII AAGCTT 1 cut(s) 951
HinfI GANTC 7 cut(s) 176, 521, 722, 965, 1169, 1373, 1571
HpaI GTTAAC 1 cut(s) 555
HpaII CCGG 2 cut(s) 55, 1773
HphI GGTGA 5 cut(s) 269, 826, 1030, 1234, 1432
Hpy166II GTNNAC 6 cut(s) 147, 192, 555, 1003, 1227, 1425
Hpy188III TCNNGA 7 cut(s) 49, 290, 320, 415, 1293, 1695, 1740
Hpy8I GTNNAC 6 cut(s) 147, 192, 555, 1003, 1227, 1425
HpyAV CCTTC 4 cut(s) 110, 132, 144, 148
HpyCH4III ACNGT 9 cut(s) 151, 216, 399, 412, 559, 879, 1083, 1485, 1689
HpyCH4IV ACGT 1 cut(s) 644
HpyF10VI GCNNNNNNNGC 6 cut(s) 11, 230, 488, 497, 760, 1319
HpySE526I ACGT 1 cut(s) 644
KspAI GTTAAC 1 cut(s) 555
Kzo9I GATC 2 cut(s) 533, 707
LguI GCTCTTC 1 cut(s) 498
LmnI GCTCC 1 cut(s) 440
LweI GCATC 3 cut(s) 250, 282, 1551
MaeI CTAG 3 cut(s) 384, 483, 497
MaeII ACGT 1 cut(s) 644
MalI GATC 2 cut(s) 535, 709
MboI GATC 2 cut(s) 533, 707
MboII GAAGA 7 cut(s) 346, 372, 485, 605, 677, 1122, 1728
MlsI TGGCCA 2 cut(s) 905, 1313
MluCI AATT 4 cut(s) 17, 294, 340, 426
MluNI TGGCCA 2 cut(s) 905, 1313
MlyI GAGTC 4 cut(s) 170, 530, 959, 1367
MmeI TCCRAC 1 cut(s) 670
MnlI CCTC 9 cut(s) 363, 630, 766, 1174, 1300, 1378, 1576, 1702, 1747
Mox20I TGGCCA 2 cut(s) 905, 1313
Mph1103I ATGCAT 1 cut(s) 275
MscI TGGCCA 2 cut(s) 905, 1313
Msp20I TGGCCA 2 cut(s) 905, 1313
MspA1I CMGCKG 2 cut(s) 209, 221
MspI CCGG 2 cut(s) 55, 1773
MspR9I CCNGG 2 cut(s) 705, 1773
Mva1269I GAATGC 1 cut(s) 1615
MvaI CCWGG 1 cut(s) 705
MwoI GCNNNNNNNGC 6 cut(s) 11, 230, 488, 497, 760, 1319
NciI CCSGG 1 cut(s) 1773
NcoI CCATGG 1 cut(s) 528
NdeII GATC 2 cut(s) 533, 707
NsiI ATGCAT 1 cut(s) 275
PagI TCATGA 1 cut(s) 289
PciSI GCTCTTC 1 cut(s) 498
PctI GAATGC 1 cut(s) 1615
PfeI GAWTC 3 cut(s) 722, 1169, 1571
PleI GAGTC 4 cut(s) 170, 529, 959, 1367
PpsI GAGTC 4 cut(s) 170, 529, 959, 1367
PpuMI RGGWCCY 1 cut(s) 119
Psp1406I AACGTT 1 cut(s) 644
Psp5II RGGWCCY 1 cut(s) 119
Psp6I CCWGG 1 cut(s) 703
PspGI CCWGG 1 cut(s) 703
PspPI GGNCC 6 cut(s) 119, 676, 812, 1622, 1742, 1775
PspPPI RGGWCCY 1 cut(s) 119
PstI CTGCAG 6 cut(s) 448, 745, 949, 1153, 1357, 1555
PstNI CAGNNNCTG 5 cut(s) 224, 974, 1178, 1382, 1550
PvuII CAGCTG 2 cut(s) 209, 221
RsaI GTAC 2 cut(s) 393, 409
RsaNI GTAC 2 cut(s) 392, 408
SapI GCTCTTC 1 cut(s) 498
Sau3AI GATC 2 cut(s) 533, 707
Sau96I GGNCC 6 cut(s) 119, 676, 812, 1622, 1742, 1775
SchI GAGTC 4 cut(s) 170, 530, 959, 1367
ScrFI CCNGG 2 cut(s) 705, 1773
SfaNI GCATC 3 cut(s) 250, 282, 1551
SfcI CTRYAG 6 cut(s) 444, 741, 945, 1149, 1353, 1551
SinI GGWCC 3 cut(s) 119, 1742, 1775
Sse9I AATT 4 cut(s) 17, 294, 340, 426
SsiI CCGC 3 cut(s) 580, 1322, 1491
SspMI CTAG 3 cut(s) 384, 483, 497
StyD4I CCNGG 2 cut(s) 703, 1771
StyI CCWWGG 5 cut(s) 528, 906, 1314, 1512, 1716
TaaI ACNGT 9 cut(s) 151, 216, 399, 412, 559, 879, 1083, 1485, 1689
TaiI ACGT 1 cut(s) 647
TaqI TCGA 1 cut(s) 414
TasI AATT 4 cut(s) 17, 294, 340, 426
TatI WGTACW 1 cut(s) 407
TfiI GAWTC 3 cut(s) 722, 1169, 1571
TspDTI ATGAA 7 cut(s) 278, 306, 353, 393, 621, 678, 735
TspGWI ACGGA 1 cut(s) 715
VpaK11BI GGWCC 3 cut(s) 119, 1742, 1775
XapI RAATTY 2 cut(s) 17, 426
XcmI CCANNNNNNNNNTGG 1 cut(s) 686
XmiI GTMKAC 1 cut(s) 146
XspI CTAG 3 cut(s) 384, 483, 497
Zsp2I ATGCAT 1 cut(s) 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.