Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8277351.1

Orthogroup ID

OG0008875

Physical Location & Seq

Genomic Coordinates Reverse (-)

336 .. 833

Gene Structure 498 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8277351.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 498 bp

atgcagtgcagcactatagagttgcaggatgcagcctatacagcactacaccaaatgctttttggaagcagcggagttctcgttttgaaccaaatcctccagatgggtctcatagagaggatggctcaatcactggaaagcaaatcaatgaagaccagggaagtgaatgtgcaatgttttctggatattgtggagctcggaaacaaagcctgcatcgagcaaatgttttcactgcaagtggtggagaagcttgtgaaaatagaaaaggctagtgggggaactagtgaaaaactgcttggattcataaagggaattgataaatgtaagcatctatctatggcagagcgtagagtgatgaaacaacaagtggttaggaagataagagcttcccttaaaggccataaatttgagatccaaattttgggagctgttgatgcttgtgtatctgagggctcaaaagtaggtagtagcagtagaggtaaacacaaaagggcatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NB-ARC

Protein Analysis

165

Amino Acids

18.23

Weight (kDa)

9.49

Isoelectric Point (pI)

49.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008875)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g30240 FvH4_6g30241
prunus_persica	Prupe.3G081300_v2.0.a1 Prupe.3G081300_v2.0.a1 Prupe.3G081300_v2.0.a1 Prupe.3G081300_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0136481
rosa_laevigata	RLG00000019535
rosa_multiflora	Rmu_co8277351.1_g000001 Rmu_co8287839.1_g000001 Rmu_ssc0000040.1_g000001
rosa_roxburghii	Rroxscaffold_2G00108250
rosa_rugosa	Rorug02G0331000 Rorug02G0331100 Rorug02G0331200
rosa_samantha	Rh2AG381900 Rh2AG382000 Rh2BG388600 Rh2CG368300 Rh2DG405100 Rh2DG405200 Rh2DG405300
rosa_wichuraiana	Rw2G031220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	421
AciI	CCGC	1 cut(s)	72
AclWI	GGATC	1 cut(s)	406
AcsI	RAATTY	2 cut(s)	404, 417
AfiI	CCNNNNNNNGG	2 cut(s)	103, 421
AgsI	TTSAA	1 cut(s)	88
AhlI	ACTAGT	1 cut(s)	281
AjnI	CCWGG	1 cut(s)	155
AjuI	GAANNNNNNNTTGG	2 cut(s)	279, 311
AluBI	AGCT	4 cut(s)	196, 250, 386, 428
AluI	AGCT	4 cut(s)	196, 250, 386, 428
Alw21I	GWGCWC	1 cut(s)	198
Alw26I	GTCTC	1 cut(s)	113
AlwI	GGATC	1 cut(s)	406
AoxI	GGCC	1 cut(s)	397
ApeKI	GCWGC	3 cut(s)	9, 32, 69
ApoI	RAATTY	2 cut(s)	404, 417
BanII	GRGCYC	2 cut(s)	198, 455
BbsI	GAAGAC	1 cut(s)	158
Bbv12I	GWGCWC	1 cut(s)	198
BbvI	GCAGC	3 cut(s)	21, 44, 81
BccI	CCATC	2 cut(s)	97, 115
BciT130I	CCWGG	1 cut(s)	157
BcoDI	GTCTC	1 cut(s)	113
BcuI	ACTAGT	1 cut(s)	281
BfaI	CTAG	2 cut(s)	270, 282
BfmI	CTRYAG	1 cut(s)	15
BisI	GCNGC	3 cut(s)	10, 33, 70
BlsI	GCNGC	3 cut(s)	11, 34, 71
Bme1390I	CCNGG	1 cut(s)	157
BmrFI	CCNGG	1 cut(s)	157
BmsI	GCATC	4 cut(s)	19, 222, 337, 424
BpiI	GAAGAC	1 cut(s)	158
BplI	GAGNNNNNCTC	2 cut(s)	109, 141
BpmI	CTGGAG	1 cut(s)	83
BsaI	GGTCTC	1 cut(s)	113
BsaJI	CCNNGG	1 cut(s)	156
BsaXI	ACNNNNNCTCC	2 cut(s)	66, 96
Bsc4I	CCNNNNNNNGG	2 cut(s)	103, 421
Bse1I	ACTGG	1 cut(s)	138
Bse3DI	GCAATG	1 cut(s)	179
BseBI	CCWGG	1 cut(s)	157
BseDI	CCNNGG	1 cut(s)	156
BseGI	GGATG	2 cut(s)	34, 126
BseLI	CCNNNNNNNGG	2 cut(s)	103, 421
BseMI	GCAATG	1 cut(s)	179
BseMII	CTCAG	1 cut(s)	438
BseNI	ACTGG	1 cut(s)	138
BseXI	GCAGC	3 cut(s)	21, 44, 81
BsgI	GTGCAG	1 cut(s)	28
BshFI	GGCC	1 cut(s)	399
BsiHKAI	GWGCWC	1 cut(s)	198
BslI	CCNNNNNNNGG	2 cut(s)	103, 421
BsmAI	GTCTC	1 cut(s)	113
BsnI	GGCC	1 cut(s)	399
Bso31I	GGTCTC	1 cut(s)	113
Bsp1286I	GDGCHC	2 cut(s)	198, 455
Bsp143I	GATC	1 cut(s)	411
BspACI	CCGC	1 cut(s)	72
BspANI	GGCC	1 cut(s)	399
BspCNI	CTCAG	1 cut(s)	439
BspPI	GGATC	1 cut(s)	406
BspTNI	GGTCTC	1 cut(s)	113
BsrDI	GCAATG	1 cut(s)	179
BsrI	ACTGG	1 cut(s)	138
BssECI	CCNNGG	1 cut(s)	156
BssMI	GATC	1 cut(s)	411
Bst2UI	CCWGG	1 cut(s)	157
BstC8I	GCNNGC	1 cut(s)	211
BstDEI	CTNAG	1 cut(s)	447
BstF5I	GGATG	2 cut(s)	34, 126
BstKTI	GATC	1 cut(s)	414
BstMAI	GTCTC	1 cut(s)	113
BstMBI	GATC	1 cut(s)	411
BstMWI	GCNNNNNNNGC	2 cut(s)	41, 434
BstNI	CCWGG	1 cut(s)	157
BstSCI	CCNGG	1 cut(s)	155
BstSFI	CTRYAG	1 cut(s)	15
BstV1I	GCAGC	3 cut(s)	21, 44, 81
BstV2I	GAAGAC	1 cut(s)	158
BstX2I	RGATCY	1 cut(s)	411
BstYI	RGATCY	1 cut(s)	411
BsuRI	GGCC	1 cut(s)	399
BtsCI	GGATG	2 cut(s)	34, 126
BtsI	GCAGTG	2 cut(s)	11, 230
BtsIMutI	CAGTG	3 cut(s)	11, 131, 230
Cac8I	GCNNGC	1 cut(s)	211
DdeI	CTNAG	1 cut(s)	447
DpnI	GATC	1 cut(s)	413
DpnII	GATC	1 cut(s)	411
Ecl136II	GAGCTC	1 cut(s)	196
Eco24I	GRGCYC	2 cut(s)	198, 455
Eco31I	GGTCTC	1 cut(s)	113
Eco53kI	GAGCTC	1 cut(s)	196
EcoICRI	GAGCTC	1 cut(s)	196
EcoRII	CCWGG	1 cut(s)	155
EcoT38I	GRGCYC	2 cut(s)	198, 455
FaiI	YATR	7 cut(s)	17, 39, 113, 305, 338, 402, 496
Fnu4HI	GCNGC	3 cut(s)	10, 33, 70
FokI	GGATG	2 cut(s)	41, 133
FriOI	GRGCYC	2 cut(s)	198, 455
Fsp4HI	GCNGC	3 cut(s)	10, 33, 70
FspBI	CTAG	2 cut(s)	270, 282
GluI	GCNGC	3 cut(s)	10, 33, 70
GsuI	CTGGAG	1 cut(s)	83
HaeIII	GGCC	1 cut(s)	399
HindIII	AAGCTT	1 cut(s)	248
HinfI	GANTC	1 cut(s)	300
Hpy166II	GTNNAC	1 cut(s)	482
Hpy188I	TCNGA	2 cut(s)	200, 448
Hpy188III	TCNNGA	2 cut(s)	100, 182
Hpy8I	GTNNAC	1 cut(s)	482
HpyCH4V	TGCA	7 cut(s)	4, 9, 25, 32, 172, 213, 235
HpyF10VI	GCNNNNNNNGC	2 cut(s)	41, 434
HpyF3I	CTNAG	1 cut(s)	447
Kzo9I	GATC	1 cut(s)	411
LmnI	GCTCC	2 cut(s)	193, 425
LpnPI	CCDG	7 cut(s)	11, 113, 119, 142, 167, 169, 223
Lsp1109I	GCAGC	3 cut(s)	21, 44, 81
LweI	GCATC	4 cut(s)	19, 222, 337, 424
MaeI	CTAG	2 cut(s)	270, 282
MalI	GATC	1 cut(s)	413
MboI	GATC	1 cut(s)	411
MboII	GAAGA	2 cut(s)	163, 388
MflI	RGATCY	1 cut(s)	411
MhlI	GDGCHC	2 cut(s)	198, 455
MluCI	AATT	3 cut(s)	312, 404, 417
MnlI	CCTC	4 cut(s)	107, 111, 442, 470
MseI	TTAA	1 cut(s)	393
MspA1I	CMGCKG	1 cut(s)	72
MspR9I	CCNGG	1 cut(s)	157
MvaI	CCWGG	1 cut(s)	157
MwoI	GCNNNNNNNGC	2 cut(s)	41, 434
NdeII	GATC	1 cut(s)	411
PfeI	GAWTC	1 cut(s)	300
PflMI	CCANNNNNTGG	1 cut(s)	421
PkrI	GCNGC	3 cut(s)	11, 34, 71
Psp124BI	GAGCTC	1 cut(s)	198
Psp6I	CCWGG	1 cut(s)	155
PspGI	CCWGG	1 cut(s)	155
PsuI	RGATCY	1 cut(s)	411
SacI	GAGCTC	1 cut(s)	198
SaqAI	TTAA	1 cut(s)	393
SatI	GCNGC	3 cut(s)	10, 33, 70
Sau3AI	GATC	1 cut(s)	411
ScrFI	CCNGG	1 cut(s)	157
SduI	GDGCHC	2 cut(s)	198, 455
SetI	ASST	6 cut(s)	198, 252, 388, 430, 466, 481
SfaNI	GCATC	4 cut(s)	19, 222, 337, 424
SfcI	CTRYAG	1 cut(s)	15
SpeI	ACTAGT	1 cut(s)	281
Sse9I	AATT	3 cut(s)	312, 404, 417
SsiI	CCGC	1 cut(s)	72
SspMI	CTAG	2 cut(s)	270, 282
SstI	GAGCTC	1 cut(s)	198
StyD4I	CCNGG	1 cut(s)	155
TaqI	TCGA	1 cut(s)	216
TasI	AATT	3 cut(s)	312, 404, 417
TfiI	GAWTC	1 cut(s)	300
Tru1I	TTAA	1 cut(s)	393
Tru9I	TTAA	1 cut(s)	393
TscAI	CASTG	2 cut(s)	138, 237
TseI	GCWGC	3 cut(s)	9, 32, 69
TspDTI	ATGAA	3 cut(s)	164, 292, 371
TspRI	CASTG	2 cut(s)	138, 237
Van91I	CCANNNNNTGG	1 cut(s)	421
XapI	RAATTY	2 cut(s)	404, 417
XcmI	CCANNNNNNNNNTGG	1 cut(s)	59
XspI	CTAG	2 cut(s)	270, 282

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.