Rmu_co8304329.1_g000001

F-actin-capping proteins bind in a Ca(2 )-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends. Unlike other capping proteins (such as gelsolin and severin), these proteins do not sever actin filaments

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8304329.1
Physical Location & Seq
Reverse (-)
2 .. 663
662 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8304329.1_g000001.1.cds

Sequence Viewer

Length: 175 bp
atgctaaaattggttcaggtttgtacagacgtgagacctgcattggataaggaacttccatccgcatatgttgaggaatacaggtgtgctttggatggagaaatacttagatatgtgggtgaagcttatccaaaaggggtctgctcagtgtattgtgggaatggtaaagatgcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.4

Weight (kDa)

4.85

Isoelectric Point (pI)

24.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 46
AciI CCGC 1 cut(s) 63
AfaI GTAC 1 cut(s) 25
AjiI CACGTC 1 cut(s) 31
AluBI AGCT 1 cut(s) 125
AluI AGCT 1 cut(s) 125
Alw26I GTCTC 1 cut(s) 28
AsuHPI GGTGA 1 cut(s) 131
BccI CCATC 2 cut(s) 67, 89
BcoDI GTCTC 1 cut(s) 28
BfuAI ACCTGC 1 cut(s) 46
BmgBI CACGTC 1 cut(s) 31
BmsI GCATC 1 cut(s) 160
BsaI GGTCTC 1 cut(s) 28
BseGI GGATG 2 cut(s) 59, 100
BseMII CTCAG 1 cut(s) 159
BsmAI GTCTC 1 cut(s) 28
Bso31I GGTCTC 1 cut(s) 28
Bsp1407I TGTACA 1 cut(s) 23
BspACI CCGC 1 cut(s) 63
BspCNI CTCAG 1 cut(s) 158
BspMI ACCTGC 1 cut(s) 46
BspTNI GGTCTC 1 cut(s) 28
BsrGI TGTACA 1 cut(s) 23
BstAUI TGTACA 1 cut(s) 23
BstDEI CTNAG 2 cut(s) 107, 145
BstF5I GGATG 2 cut(s) 59, 100
BstMAI GTCTC 1 cut(s) 28
BtrI CACGTC 1 cut(s) 31
BtsCI GGATG 2 cut(s) 59, 100
BtsIMutI CAGTG 1 cut(s) 153
BveI ACCTGC 1 cut(s) 46
Csp6I GTAC 1 cut(s) 24
CviJI RGCY 1 cut(s) 125
CviKI_1 RGCY 1 cut(s) 125
CviQI GTAC 1 cut(s) 24
DdeI CTNAG 2 cut(s) 107, 145
Eco31I GGTCTC 1 cut(s) 28
FaiI YATR 3 cut(s) 67, 69, 114
FauNDI CATATG 1 cut(s) 67
FokI GGATG 2 cut(s) 46, 107
HindIII AAGCTT 1 cut(s) 123
HphI GGTGA 1 cut(s) 131
HpyCH4IV ACGT 1 cut(s) 30
HpyCH4V TGCA 2 cut(s) 41, 173
HpyF3I CTNAG 2 cut(s) 107, 145
HpySE526I ACGT 1 cut(s) 30
LpnPI CCDG 3 cut(s) 2, 51, 67
LweI GCATC 1 cut(s) 160
MaeII ACGT 1 cut(s) 30
MluCI AATT 1 cut(s) 8
MnlI CCTC 1 cut(s) 67
NdeI CATATG 1 cut(s) 67
RsaI GTAC 1 cut(s) 25
RsaNI GTAC 1 cut(s) 24
SetI ASST 5 cut(s) 21, 33, 40, 86, 127
SfaNI GCATC 1 cut(s) 160
SgeI CNNG 4 cut(s) 29, 43, 50, 94
Sse9I AATT 1 cut(s) 8
SsiI CCGC 1 cut(s) 63
TaiI ACGT 1 cut(s) 33
TasI AATT 1 cut(s) 8
TatI WGTACW 1 cut(s) 23
TscAI CASTG 1 cut(s) 153
TspRI CASTG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.