Rmu_co8328167.1_g000001

splicing factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8328167.1
Physical Location & Seq
Reverse (-)
1 .. 426
426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8328167.1_g000001.1.cds

Sequence Viewer

Length: 176 bp
atgaagcgaagggaacctcggggatttgcattcgtgcaatttgtggattcttatgaagctgcagaggctcagtatcatatgaatgggaaaatttttgctgggagggagatatctgtggttcttgctgcagagacaaggaaaagaccagaggagatgcgccaaagaactagggtcag

Protein Analysis

58

Amino Acids

6.85

Weight (kDa)

10.13

Isoelectric Point (pI)

42.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 90
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
Alw26I GTCTC 1 cut(s) 125
Ama87I CYCGRG 1 cut(s) 18
ApeKI GCWGC 2 cut(s) 59, 125
ApoI RAATTY 1 cut(s) 90
AspLEI GCGC 1 cut(s) 159
AvaI CYCGRG 1 cut(s) 18
BbvI GCAGC 2 cut(s) 46, 112
BcoDI GTCTC 1 cut(s) 125
BfaI CTAG 1 cut(s) 168
BfmI CTRYAG 2 cut(s) 60, 126
BisI GCNGC 2 cut(s) 60, 126
BlsI GCNGC 2 cut(s) 61, 127
BmeT110I CYCGRG 1 cut(s) 18
BmiI GGNNCC 1 cut(s) 15
BmsI GCATC 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 17
BseDI CCNNGG 1 cut(s) 17
BseMII CTCAG 1 cut(s) 83
BseRI GAGGAG 1 cut(s) 164
BseXI GCAGC 2 cut(s) 46, 112
BseYI CCCAGC 1 cut(s) 98
BsiHKCI CYCGRG 1 cut(s) 18
BsmAI GTCTC 1 cut(s) 125
BsmI GAATGC 1 cut(s) 29
BsoBI CYCGRG 1 cut(s) 18
BspCNI CTCAG 1 cut(s) 82
BspLI GGNNCC 1 cut(s) 15
BspMAI CTGCAG 2 cut(s) 64, 130
BssECI CCNNGG 1 cut(s) 17
BstDEI CTNAG 1 cut(s) 69
BstHHI GCGC 1 cut(s) 159
BstMAI GTCTC 1 cut(s) 125
BstMWI GCNNNNNNNGC 1 cut(s) 65
BstSFI CTRYAG 2 cut(s) 60, 126
BstV1I GCAGC 2 cut(s) 46, 112
CfoI GCGC 1 cut(s) 159
CviJI RGCY 2 cut(s) 59, 68
CviKI_1 RGCY 2 cut(s) 59, 68
DdeI CTNAG 1 cut(s) 69
Eco32I GATATC 1 cut(s) 111
Eco88I CYCGRG 1 cut(s) 18
EcoRV GATATC 1 cut(s) 111
FaiI YATR 3 cut(s) 54, 78, 80
FauNDI CATATG 1 cut(s) 78
Fnu4HI GCNGC 2 cut(s) 60, 126
Fsp4HI GCNGC 2 cut(s) 60, 126
FspBI CTAG 1 cut(s) 168
GlaI GCGC 1 cut(s) 158
GluI GCNGC 2 cut(s) 60, 126
GsaI CCCAGC 1 cut(s) 102
HhaI GCGC 1 cut(s) 159
Hin6I GCGC 1 cut(s) 157
HinP1I GCGC 1 cut(s) 157
HinfI GANTC 1 cut(s) 47
HpyAV CCTTC 1 cut(s) 3
HpyCH4V TGCA 4 cut(s) 29, 37, 62, 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
HpyF3I CTNAG 1 cut(s) 69
HspAI GCGC 1 cut(s) 157
LpnPI CCDG 2 cut(s) 84, 159
Lsp1109I GCAGC 2 cut(s) 46, 112
LweI GCATC 1 cut(s) 144
MaeI CTAG 1 cut(s) 168
MluCI AATT 2 cut(s) 38, 90
MnlI CCTC 4 cut(s) 27, 58, 96, 142
MslI CAYNNNNRTG 1 cut(s) 81
Mva1269I GAATGC 1 cut(s) 29
MwoI GCNNNNNNNGC 1 cut(s) 65
NdeI CATATG 1 cut(s) 78
NlaIV GGNNCC 1 cut(s) 15
PctI GAATGC 1 cut(s) 29
PfeI GAWTC 1 cut(s) 47
PkrI GCNGC 2 cut(s) 61, 127
PspFI CCCAGC 1 cut(s) 98
PspN4I GGNNCC 1 cut(s) 15
PstI CTGCAG 2 cut(s) 64, 130
RseI CAYNNNNRTG 1 cut(s) 81
SatI GCNGC 2 cut(s) 60, 126
SetI ASST 2 cut(s) 19, 61
SfaNI GCATC 1 cut(s) 144
SfcI CTRYAG 2 cut(s) 60, 126
SgeI CNNG 7 cut(s) 30, 32, 46, 111, 134, 147, 158
SmiMI CAYNNNNRTG 1 cut(s) 81
Sse9I AATT 2 cut(s) 38, 90
SspMI CTAG 1 cut(s) 168
TasI AATT 2 cut(s) 38, 90
TfiI GAWTC 1 cut(s) 47
TseI GCWGC 2 cut(s) 59, 125
TspDTI ATGAA 3 cut(s) 17, 69, 95
XapI RAATTY 1 cut(s) 90
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.