Rmu_co8366833.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8366833.1
Physical Location & Seq
Reverse (-)
2 .. 735
734 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8366833.1_g000001.1.cds

Sequence Viewer

Length: 734 bp
atggaagacaaagttgaatggaaaggagaagaaaaggttaacaaggaagaactccatttagtgatcaagaccaaggatgcagaactaggcggtgactccaaggaggaaaagactgagaaggaacttgaaataaagaccaagtcggtggaaaaactgaagccaaagtataaggaggaggaggagaaagacacgaaaacgaacaaggaaaaagagaaagaagaagatgaagagttgaagaagacagagaacaaagataaaaagaaggacaaggataaacaaggaaagaagaagaagaaaaagagcaaagatactgggggctcagaagatgatggagagagggatcaaaaagagaaaaagaagaaagacaaacaagagaagaagaacaaaggtaaagggttagatgaagaagaagaagagatagaatgcaaagatgaaaaatcgagtgttaaggatgattctaagcacacagaggaagagctggacaaaaatgaagagaagaagaataagctcaaggtagatgaagaaagcaatgaccagaaagaagagaaaaagaaggttaaagataagaaagagcagaaagaagagaaaaagaagggtaaaaataaagaagaggaggatcgggataatgaggatgaggacaatgaagaaaaggaagggaaaaagaagaagaagaagaaggataaggaaaaatatgatgacaatgaaaaagaggggaagaagaagaaagataagaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

244

Amino Acids

29.12

Weight (kDa)

6.16

Isoelectric Point (pI)

50.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 90
AclWI GGATC 2 cut(s) 348, 624
AcuI CTGAAG 1 cut(s) 176
AgsI TTSAA 3 cut(s) 17, 128, 235
AluBI AGCT 2 cut(s) 478, 508
AluI AGCT 2 cut(s) 478, 508
AlwI GGATC 2 cut(s) 348, 624
AsuHPI GGTGA 1 cut(s) 104
BanII GRGCYC 1 cut(s) 320
BbsI GAAGAC 2 cut(s) 12, 245
BccI CCATC 1 cut(s) 323
BclI TGATCA 1 cut(s) 63
BfaI CTAG 1 cut(s) 86
BmrI ACTGGG 1 cut(s) 321
BmsI GCATC 1 cut(s) 67
BmuI ACTGGG 1 cut(s) 321
BpiI GAAGAC 2 cut(s) 12, 245
BpuEI CTTGAG 1 cut(s) 494
BsaJI CCNNGG 2 cut(s) 72, 99
Bse1I ACTGG 1 cut(s) 316
Bse3DI GCAATG 1 cut(s) 535
BseDI CCNNGG 2 cut(s) 72, 99
BseGI GGATG 3 cut(s) 82, 457, 637
BseMI GCAATG 1 cut(s) 535
BseMII CTCAG 2 cut(s) 105, 333
BseNI ACTGG 1 cut(s) 316
BseRI GAGGAG 4 cut(s) 188, 191, 194, 626
BsmI GAATGC 1 cut(s) 428
Bsp1286I GDGCHC 1 cut(s) 320
Bsp143I GATC 3 cut(s) 63, 340, 616
BspACI CCGC 1 cut(s) 90
BspCNI CTCAG 2 cut(s) 106, 332
BspPI GGATC 2 cut(s) 348, 624
BspQI GCTCTTC 1 cut(s) 468
BsrDI GCAATG 1 cut(s) 535
BsrI ACTGG 1 cut(s) 316
BssECI CCNNGG 2 cut(s) 72, 99
BssMI GATC 3 cut(s) 63, 340, 616
BssT1I CCWWGG 2 cut(s) 72, 99
Bst6I CTCTTC 7 cut(s) 222, 408, 468, 486, 537, 576, 603
BstDEI CTNAG 3 cut(s) 114, 319, 459
BstF5I GGATG 3 cut(s) 82, 457, 637
BstKTI GATC 3 cut(s) 66, 343, 619
BstMBI GATC 3 cut(s) 63, 340, 616
BstV2I GAAGAC 2 cut(s) 12, 245
BstXI CCANNNNNNTGG 1 cut(s) 145
BtsCI GGATG 3 cut(s) 82, 457, 637
CviJI RGCY 4 cut(s) 160, 318, 478, 508
CviKI_1 RGCY 4 cut(s) 160, 318, 478, 508
DdeI CTNAG 3 cut(s) 114, 319, 459
DpnI GATC 3 cut(s) 65, 342, 618
DpnII GATC 3 cut(s) 63, 340, 616
Eam1104I CTCTTC 7 cut(s) 222, 408, 468, 486, 537, 576, 603
EarI CTCTTC 7 cut(s) 222, 408, 468, 486, 537, 576, 603
Eco130I CCWWGG 2 cut(s) 72, 99
Eco24I GRGCYC 1 cut(s) 320
Eco57I CTGAAG 1 cut(s) 176
EcoT14I CCWWGG 2 cut(s) 72, 99
EcoT38I GRGCYC 1 cut(s) 320
ErhI CCWWGG 2 cut(s) 72, 99
FaiI YATR 2 cut(s) 168, 693
FbaI TGATCA 1 cut(s) 63
FokI GGATG 3 cut(s) 89, 464, 644
FriOI GRGCYC 1 cut(s) 320
FspBI CTAG 1 cut(s) 86
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
HinfI GANTC 2 cut(s) 95, 455
HpaI GTTAAC 1 cut(s) 40
HphI GGTGA 1 cut(s) 104
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 322
Hpy188III TCNNGA 2 cut(s) 67, 620
Hpy8I GTNNAC 1 cut(s) 40
HpyAV CCTTC 6 cut(s) 112, 256, 547, 586, 647, 670
HpyCH4V TGCA 2 cut(s) 80, 426
HpyF3I CTNAG 3 cut(s) 114, 319, 459
Ksp22I TGATCA 1 cut(s) 63
KspAI GTTAAC 1 cut(s) 40
Kzo9I GATC 3 cut(s) 63, 340, 616
LguI GCTCTTC 1 cut(s) 468
LpnPI CCDG 3 cut(s) 297, 464, 548
LweI GCATC 1 cut(s) 67
MaeI CTAG 1 cut(s) 86
MaeIII GTNAC 1 cut(s) 92
MalI GATC 3 cut(s) 65, 342, 618
MboI GATC 3 cut(s) 63, 340, 616
MhlI GDGCHC 1 cut(s) 320
MlyI GAGTC 1 cut(s) 89
MseI TTAA 3 cut(s) 39, 447, 558
Mva1269I GAATGC 1 cut(s) 428
NdeII GATC 3 cut(s) 63, 340, 616
NmuCI GTSAC 1 cut(s) 92
PciSI GCTCTTC 1 cut(s) 468
PctI GAATGC 1 cut(s) 428
PfeI GAWTC 1 cut(s) 455
PflFI GACNNNGTC 1 cut(s) 139
PleI GAGTC 1 cut(s) 89
PpsI GAGTC 1 cut(s) 89
PsyI GACNNNGTC 1 cut(s) 139
SapI GCTCTTC 1 cut(s) 468
SaqAI TTAA 3 cut(s) 39, 447, 558
Sau3AI GATC 3 cut(s) 63, 340, 616
SchI GAGTC 1 cut(s) 89
SduI GDGCHC 1 cut(s) 320
SetI ASST 6 cut(s) 39, 391, 480, 510, 516, 558
SfaNI GCATC 1 cut(s) 67
SmlI CTYRAG 1 cut(s) 509
SmoI CTYRAG 1 cut(s) 509
SsiI CCGC 1 cut(s) 90
SspMI CTAG 1 cut(s) 86
StyI CCWWGG 2 cut(s) 72, 99
TaqI TCGA 1 cut(s) 440
TfiI GAWTC 1 cut(s) 455
Tru1I TTAA 3 cut(s) 39, 447, 558
Tru9I TTAA 3 cut(s) 39, 447, 558
TseFI GTSAC 1 cut(s) 92
Tsp45I GTSAC 1 cut(s) 92
TspDTI ATGAA 7 cut(s) 240, 417, 447, 504, 534, 657, 717
Tth111I GACNNNGTC 1 cut(s) 139
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.