Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8367077.1

Orthogroup ID

OG0013668

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 660

Gene Structure 659 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8367077.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 533 bp

ctggctcatcgggttgcagagccctatcctggcaccactaatctgagcaagttgcttggactatatgcaaatgaacttctctgccacgtagcatttggaagagatttctcaggtggtggagagtatgatcagcatggtttccaaaagatgcttgaggaataccaggaattgcttggcagattttctattggagatttcttcccttctatggagtttctgcacaccttaacaggaatgaaatcaagacttcaagagacattcgggagattcgataaacaatttgaccagatgataactgaacatcaaaatcccaaaagagaaaaacaggagcacaaggaccccgtggatgttttactggatatacagaaaaaagattctgctgacatgcctctcaccatggataatgtcaaggctattatcttggacatgtttgccgcaggaactgacacaaccttcatcacccttgattggggaatgacagagcttttgatgaaccccaaagtcctggaaaaggcacaagctgaagtacaagg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0012505 GO:0016020 GO:0031090 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0098827

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

p450

Protein Analysis

178

Amino Acids

20.28

Weight (kDa)

5.0

Isoelectric Point (pI)

34.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013668)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g06600
malus_domestica	MD14G1168600.v1.1
rosa_chinensis	RchiOBHm_Chr7g0192161
rosa_laevigata	RLG00000004391 RLG00000004392
rosa_multiflora	Rmu_co8367077.1_g000001 Rmu_co8395345.1_g000001 Rmu_sc0002164.1_g000020
rosa_roxburghii	Rroxscaffold_3G00263240 Rroxscaffold_3G00263250
rosa_rugosa	Rorug06G0513300
rosa_samantha	Rh7AG123600 Rh7AG123700 Rh7BG125300 Rh7BG125500 Rh7DG127200 Rh7DG127300
rosa_wichuraiana	Rw7G010570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	32
AciI	CCGC	1 cut(s)	435
AfaI	GTAC	1 cut(s)	528
AfiI	CCNNNNNNNGG	5 cut(s)	29, 208, 468, 469, 511
AflIII	ACRYGT	1 cut(s)	426
AgsI	TTSAA	1 cut(s)	251
AjnI	CCWGG	3 cut(s)	28, 162, 504
AluBI	AGCT	2 cut(s)	484, 521
AluI	AGCT	2 cut(s)	484, 521
Alw21I	GWGCWC	1 cut(s)	333
Alw26I	GTCTC	1 cut(s)	248
AlwNI	CAGNNNCTG	1 cut(s)	443
ArsI	GACNNNNNNTTYG	2 cut(s)	469, 501
AspS9I	GGNCC	1 cut(s)	337
AsuHPI	GGTGA	2 cut(s)	385, 451
AvaII	GGWCC	1 cut(s)	337
BanI	GGYRCC	1 cut(s)	32
BanII	GRGCYC	1 cut(s)	24
Bbv12I	GWGCWC	1 cut(s)	333
BciT130I	CCWGG	3 cut(s)	30, 164, 506
BclI	TGATCA	1 cut(s)	127
BcoDI	GTCTC	1 cut(s)	248
BisI	GCNGC	1 cut(s)	435
BlsI	GCNGC	1 cut(s)	436
Bme1390I	CCNGG	3 cut(s)	30, 164, 506
Bme18I	GGWCC	1 cut(s)	337
BmgT120I	GGNCC	1 cut(s)	337
BmiI	GGNNCC	2 cut(s)	34, 339
BmrFI	CCNGG	3 cut(s)	30, 164, 506
BmsI	GCATC	1 cut(s)	138
BpuEI	CTTGAG	1 cut(s)	173
BsaAI	YACGTR	1 cut(s)	88
BsaJI	CCNNGG	2 cut(s)	342, 396
Bsc4I	CCNNNNNNNGG	5 cut(s)	29, 208, 468, 469, 511
Bse1I	ACTGG	1 cut(s)	360
BseBI	CCWGG	3 cut(s)	30, 164, 506
BseDI	CCNNGG	2 cut(s)	342, 396
BseGI	GGATG	1 cut(s)	352
BseLI	CCNNNNNNNGG	5 cut(s)	29, 208, 468, 469, 511
BseMII	CTCAG	2 cut(s)	35, 123
BseNI	ACTGG	1 cut(s)	360
BsgI	GTGCAG	1 cut(s)	203
BshNI	GGYRCC	1 cut(s)	32
BsiHKAI	GWGCWC	1 cut(s)	333
BslI	CCNNNNNNNGG	5 cut(s)	29, 208, 468, 469, 511
BsmAI	GTCTC	1 cut(s)	248
Bsp1286I	GDGCHC	2 cut(s)	24, 333
Bsp143I	GATC	1 cut(s)	127
Bsp19I	CCATGG	1 cut(s)	396
BspACI	CCGC	1 cut(s)	435
BspCNI	CTCAG	2 cut(s)	36, 122
BspLI	GGNNCC	2 cut(s)	34, 339
BspT107I	GGYRCC	1 cut(s)	32
BsrI	ACTGG	1 cut(s)	360
BssECI	CCNNGG	2 cut(s)	342, 396
BssMI	GATC	1 cut(s)	127
BssT1I	CCWWGG	1 cut(s)	396
Bst2UI	CCWGG	3 cut(s)	30, 164, 506
Bst6I	CTCTTC	1 cut(s)	94
BstBAI	YACGTR	1 cut(s)	88
BstDEI	CTNAG	2 cut(s)	44, 109
BstDSI	CCRYGG	2 cut(s)	342, 396
BstENI	CCTNNNNNAGG	1 cut(s)	509
BstF5I	GGATG	1 cut(s)	352
BstKTI	GATC	1 cut(s)	130
BstMAI	GTCTC	1 cut(s)	248
BstMBI	GATC	1 cut(s)	127
BstNI	CCWGG	3 cut(s)	30, 164, 506
BstNSI	RCATGY	2 cut(s)	388, 430
BstSCI	CCNGG	3 cut(s)	28, 162, 504
BstXI	CCANNNNNNTGG	1 cut(s)	505
BtgI	CCRYGG	2 cut(s)	342, 396
BtsCI	GGATG	1 cut(s)	352
CaiI	CAGNNNCTG	1 cut(s)	443
Cfr13I	GGNCC	1 cut(s)	337
Csp6I	GTAC	1 cut(s)	527
CviAII	CATG	4 cut(s)	134, 385, 397, 427
CviJI	RGCY	5 cut(s)	5, 22, 413, 484, 521
CviKI_1	RGCY	5 cut(s)	5, 22, 413, 484, 521
CviQI	GTAC	1 cut(s)	527
DdeI	CTNAG	2 cut(s)	44, 109
DpnI	GATC	1 cut(s)	129
DpnII	GATC	1 cut(s)	127
Eam1104I	CTCTTC	1 cut(s)	94
EarI	CTCTTC	1 cut(s)	94
Eco130I	CCWWGG	1 cut(s)	396
Eco24I	GRGCYC	1 cut(s)	24
Eco47I	GGWCC	1 cut(s)	337
EcoNI	CCTNNNNNAGG	1 cut(s)	509
EcoO109I	RGGNCCY	1 cut(s)	337
EcoRII	CCWGG	3 cut(s)	28, 162, 504
EcoT14I	CCWWGG	1 cut(s)	396
EcoT38I	GRGCYC	1 cut(s)	24
ErhI	CCWWGG	1 cut(s)	396
FaeI	CATG	4 cut(s)	137, 388, 400, 430
FaiI	YATR	9 cut(s)	64, 66, 126, 135, 209, 362, 386, 398, 428
FatI	CATG	4 cut(s)	133, 384, 396, 426
FbaI	TGATCA	1 cut(s)	127
Fnu4HI	GCNGC	1 cut(s)	435
FokI	GGATG	1 cut(s)	359
FriOI	GRGCYC	1 cut(s)	24
Fsp4HI	GCNGC	1 cut(s)	435
GluI	GCNGC	1 cut(s)	435
Hin1II	CATG	4 cut(s)	137, 388, 400, 430
HinfI	GANTC	2 cut(s)	267, 374
HphI	GGTGA	2 cut(s)	385, 451
Hpy188I	TCNGA	1 cut(s)	45
Hpy188III	TCNNGA	3 cut(s)	243, 251, 262
HpyAV	CCTTC	2 cut(s)	213, 463
HpyCH4IV	ACGT	1 cut(s)	87
HpyCH4V	TGCA	3 cut(s)	17, 68, 220
HpyF3I	CTNAG	2 cut(s)	44, 109
HpySE526I	ACGT	1 cut(s)	87
Hsp92II	CATG	4 cut(s)	137, 388, 400, 430
Ksp22I	TGATCA	1 cut(s)	127
Kzo9I	GATC	1 cut(s)	127
LmnI	GCTCC	1 cut(s)	328
LweI	GCATC	1 cut(s)	138
MaeII	ACGT	1 cut(s)	87
MalI	GATC	1 cut(s)	129
MboI	GATC	1 cut(s)	127
MboII	GAAGA	2 cut(s)	111, 190
MhlI	GDGCHC	2 cut(s)	24, 333
MluCI	AATT	2 cut(s)	167, 278
MnlI	CCTC	2 cut(s)	148, 399
MseI	TTAA	1 cut(s)	227
MspR9I	CCNGG	3 cut(s)	30, 164, 506
MvaI	CCWGG	3 cut(s)	30, 164, 506
NcoI	CCATGG	1 cut(s)	396
NdeII	GATC	1 cut(s)	127
NlaIII	CATG	4 cut(s)	137, 388, 400, 430
NlaIV	GGNNCC	2 cut(s)	34, 339
NspI	RCATGY	2 cut(s)	388, 430
PciI	ACATGT	1 cut(s)	426
PcsI	WCGNNNNNNNCGW	1 cut(s)	267
PfeI	GAWTC	2 cut(s)	267, 374
PfoI	TCCNGGA	1 cut(s)	504
PkrI	GCNGC	1 cut(s)	436
Ppu21I	YACGTR	1 cut(s)	88
PpuMI	RGGWCCY	1 cut(s)	337
PscI	ACATGT	1 cut(s)	426
Psp5II	RGGWCCY	1 cut(s)	337
Psp6I	CCWGG	3 cut(s)	28, 162, 504
PspGI	CCWGG	3 cut(s)	28, 162, 504
PspN4I	GGNNCC	2 cut(s)	34, 339
PspPI	GGNCC	1 cut(s)	337
PspPPI	RGGWCCY	1 cut(s)	337
PstNI	CAGNNNCTG	1 cut(s)	443
RsaI	GTAC	1 cut(s)	528
RsaNI	GTAC	1 cut(s)	527
SaqAI	TTAA	1 cut(s)	227
SatI	GCNGC	1 cut(s)	435
Sau3AI	GATC	1 cut(s)	127
Sau96I	GGNCC	1 cut(s)	337
ScrFI	CCNGG	3 cut(s)	30, 164, 506
SduI	GDGCHC	2 cut(s)	24, 333
SetI	ASST	6 cut(s)	90, 115, 227, 455, 486, 523
SfaNI	GCATC	1 cut(s)	138
SinI	GGWCC	1 cut(s)	337
SmlI	CTYRAG	1 cut(s)	152
SmoI	CTYRAG	1 cut(s)	152
Sse9I	AATT	2 cut(s)	167, 278
SsiI	CCGC	1 cut(s)	435
StyD4I	CCNGG	3 cut(s)	28, 162, 504
StyI	CCWWGG	1 cut(s)	396
TaiI	ACGT	1 cut(s)	90
TaqI	TCGA	1 cut(s)	270
TasI	AATT	2 cut(s)	167, 278
TatI	WGTACW	1 cut(s)	526
TauI	GCSGC	1 cut(s)	437
TfiI	GAWTC	2 cut(s)	267, 374
Tru1I	TTAA	1 cut(s)	227
Tru9I	TTAA	1 cut(s)	227
TspDTI	ATGAA	4 cut(s)	87, 251, 445, 506
VpaK11BI	GGWCC	1 cut(s)	337
XagI	CCTNNNNNAGG	1 cut(s)	509
XceI	RCATGY	2 cut(s)	388, 430
XcmI	CCANNNNNNNNNTGG	2 cut(s)	92, 170

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.