Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8379347.1

Orthogroup ID

OG0009176

Physical Location & Seq

Genomic Coordinates Forward (+)

34 .. 519

Gene Structure 486 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8379347.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 246 bp

atgacaaatcacatgtcgtgggggacagacaactctgaatcatttttggaagttgatgtgaagttaaatctcaccctcgagatctatacgctcccttttaccatgatgccggtatcagctgttgagcgtccgggaaacttaatgatgcaagcattactggataggctggtcccactgcttctgcagcaactcctacaagattatgacaaatgggttcataagcattcagaagatgattttccatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1997

Protein Analysis

81

Amino Acids

9.45

Weight (kDa)

4.53

Isoelectric Point (pI)

50.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009176)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G31115 AT4G31115
fragaria_vesca	FvH4_4g12330
malus_domestica	MD08G1133200.v1.1
prunus_persica	Prupe.1G463100_v2.0.a1 Prupe.1G463100_v2.0.a1 Prupe.1G463100_v2.0.a1 Prupe.1G463100_v2.0.a1
pyrus_communis	pycom08g11210
rosa_chinensis	RchiOBHm_Chr4g0410411
rosa_laevigata	RLG00000008431
rosa_multiflora	Rmu_co8379347.1_g000001 Rmu_sc0002111.1_g000015
rosa_roxburghii	Rroxscaffold_5G00355220
rosa_rugosa	Rorug04G0102400 Rorug04G0102500 Rorug04G0102600
rosa_samantha	Rh4AG160500 Rh4BG159700 Rh4CG172600 Rh4DG155400
rosa_wichuraiana	Rw4G013380

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AflIII	ACRYGT	1 cut(s)	12
AluBI	AGCT	1 cut(s)	119
AluI	AGCT	1 cut(s)	119
Ama87I	CYCGRG	1 cut(s)	77
ApeKI	GCWGC	1 cut(s)	184
ArsI	GACNNNNNNTTYG	1 cut(s)	31
AspS9I	GGNCC	1 cut(s)	169
AsuC2I	CCSGG	1 cut(s)	132
AsuHPI	GGTGA	1 cut(s)	64
AvaI	CYCGRG	1 cut(s)	77
AvaII	GGWCC	1 cut(s)	169
BbvI	GCAGC	1 cut(s)	196
BcnI	CCSGG	1 cut(s)	132
BfmI	CTRYAG	1 cut(s)	182
BglII	AGATCT	1 cut(s)	81
BisI	GCNGC	1 cut(s)	185
BlsI	GCNGC	1 cut(s)	186
Bme1390I	CCNGG	1 cut(s)	132
Bme18I	GGWCC	1 cut(s)	169
BmeT110I	CYCGRG	1 cut(s)	77
BmgT120I	GGNCC	1 cut(s)	169
BmiI	GGNNCC	1 cut(s)	171
BmrFI	CCNGG	1 cut(s)	132
BmsI	GCATC	2 cut(s)	96, 135
BpuMI	CCSGG	1 cut(s)	132
Bse118I	RCCGGY	1 cut(s)	109
Bse1I	ACTGG	1 cut(s)	162
BseNI	ACTGG	1 cut(s)	162
BseXI	GCAGC	1 cut(s)	196
BsiHKCI	CYCGRG	1 cut(s)	77
BsiSI	CCGG	2 cut(s)	110, 131
BslFI	GGGAC	2 cut(s)	37, 155
BsmFI	GGGAC	2 cut(s)	37, 155
BsmI	GAATGC	1 cut(s)	223
BsoBI	CYCGRG	1 cut(s)	77
Bsp143I	GATC	1 cut(s)	81
BspLI	GGNNCC	1 cut(s)	171
BspMAI	CTGCAG	1 cut(s)	186
BsrFI	RCCGGY	1 cut(s)	109
BsrI	ACTGG	1 cut(s)	162
BssAI	RCCGGY	1 cut(s)	109
BssMI	GATC	1 cut(s)	81
BstC8I	GCNNGC	1 cut(s)	150
BstKTI	GATC	1 cut(s)	84
BstMBI	GATC	1 cut(s)	81
BstMWI	GCNNNNNNNGC	1 cut(s)	184
BstNSI	RCATGY	1 cut(s)	16
BstSCI	CCNGG	1 cut(s)	130
BstSFI	CTRYAG	1 cut(s)	182
BstV1I	GCAGC	1 cut(s)	196
BstX2I	RGATCY	1 cut(s)	81
BstYI	RGATCY	1 cut(s)	81
BtsI	GCAGTG	1 cut(s)	173
BtsIMutI	CAGTG	1 cut(s)	173
Cac8I	GCNNGC	1 cut(s)	150
Cfr10I	RCCGGY	1 cut(s)	109
Cfr13I	GGNCC	1 cut(s)	169
CseI	GACGC	1 cut(s)	116
CviAII	CATG	3 cut(s)	13, 103, 243
CviJI	RGCY	2 cut(s)	119, 166
CviKI_1	RGCY	2 cut(s)	119, 166
DpnI	GATC	1 cut(s)	83
DpnII	GATC	1 cut(s)	81
Eco47I	GGWCC	1 cut(s)	169
Eco88I	CYCGRG	1 cut(s)	77
FaeI	CATG	3 cut(s)	16, 106, 246
FaiI	YATR	6 cut(s)	14, 87, 104, 204, 219, 244
FaqI	GGGAC	2 cut(s)	37, 155
FatI	CATG	3 cut(s)	12, 102, 242
Fnu4HI	GCNGC	1 cut(s)	185
Fsp4HI	GCNGC	1 cut(s)	185
GluI	GCNGC	1 cut(s)	185
HapII	CCGG	2 cut(s)	110, 131
HgaI	GACGC	1 cut(s)	116
Hin1II	CATG	3 cut(s)	16, 106, 246
HinfI	GANTC	1 cut(s)	38
HpaII	CCGG	2 cut(s)	110, 131
HphI	GGTGA	1 cut(s)	64
Hpy188I	TCNGA	2 cut(s)	37, 229
Hpy188III	TCNNGA	1 cut(s)	79
HpyCH4V	TGCA	2 cut(s)	148, 184
HpyF10VI	GCNNNNNNNGC	1 cut(s)	184
Hsp92II	CATG	3 cut(s)	16, 106, 246
Kzo9I	GATC	1 cut(s)	81
LmnI	GCTCC	1 cut(s)	96
LpnPI	CCDG	4 cut(s)	123, 143, 144, 152
Lsp1109I	GCAGC	1 cut(s)	196
LweI	GCATC	2 cut(s)	96, 135
MalI	GATC	1 cut(s)	83
MboI	GATC	1 cut(s)	81
MboII	GAAGA	1 cut(s)	242
MflI	RGATCY	1 cut(s)	81
MnlI	CCTC	1 cut(s)	86
MseI	TTAA	2 cut(s)	65, 140
MspA1I	CMGCKG	1 cut(s)	119
MspI	CCGG	2 cut(s)	110, 131
MspR9I	CCNGG	1 cut(s)	132
Mva1269I	GAATGC	1 cut(s)	223
MwoI	GCNNNNNNNGC	1 cut(s)	184
NciI	CCSGG	1 cut(s)	132
NdeII	GATC	1 cut(s)	81
NlaIII	CATG	3 cut(s)	16, 106, 246
NlaIV	GGNNCC	1 cut(s)	171
NspI	RCATGY	1 cut(s)	16
PaeR7I	CTCGAG	1 cut(s)	77
PciI	ACATGT	1 cut(s)	12
PctI	GAATGC	1 cut(s)	223
PfeI	GAWTC	1 cut(s)	38
PfoI	TCCNGGA	1 cut(s)	130
PkrI	GCNGC	1 cut(s)	186
PscI	ACATGT	1 cut(s)	12
PspN4I	GGNNCC	1 cut(s)	171
PspPI	GGNCC	1 cut(s)	169
PstI	CTGCAG	1 cut(s)	186
PsuI	RGATCY	1 cut(s)	81
PvuII	CAGCTG	1 cut(s)	119
SaqAI	TTAA	2 cut(s)	65, 140
SatI	GCNGC	1 cut(s)	185
Sau3AI	GATC	1 cut(s)	81
Sau96I	GGNCC	1 cut(s)	169
ScrFI	CCNGG	1 cut(s)	132
SetI	ASST	1 cut(s)	121
SfaNI	GCATC	2 cut(s)	96, 135
SfcI	CTRYAG	1 cut(s)	182
Sfr274I	CTCGAG	1 cut(s)	77
SinI	GGWCC	1 cut(s)	169
SlaI	CTCGAG	1 cut(s)	77
SmlI	CTYRAG	1 cut(s)	77
SmoI	CTYRAG	1 cut(s)	77
StyD4I	CCNGG	1 cut(s)	130
TaqI	TCGA	1 cut(s)	78
TfiI	GAWTC	1 cut(s)	38
Tru1I	TTAA	2 cut(s)	65, 140
Tru9I	TTAA	2 cut(s)	65, 140
TscAI	CASTG	1 cut(s)	180
TseI	GCWGC	1 cut(s)	184
TspDTI	ATGAA	1 cut(s)	206
TspRI	CASTG	1 cut(s)	180
VpaK11BI	GGWCC	1 cut(s)	169
XceI	RCATGY	1 cut(s)	16
XhoI	CTCGAG	1 cut(s)	77

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.